96 resultados para INTERLEUKIN-10 PROMOTER
Resumo:
Mouse bone marrow-derived mast cells (BMMCs) developed with interleukin 3 (IL-3) can be stimulated by c-kit ligand (KL) and accessory cytokines over a period of hours for direct delayed prostaglandin (PG) generation or over a period of days to prime for augmented IgE-dependent PG and leukotriene (LT) production, as previously reported. We now report that IL-4 is counterregulatory for each of these distinct KL-dependent responses. BMMCs cultured for 4 days with KL + IL-3 or with KL + IL-10 produced 5- to 7-fold more PGD2 and approximately 2-fold more LTC4 in response to IgE-dependent activation than BMMCs maintained in IL-3 alone. IL-4 inhibited the priming for increased IgE-dependent PGD2 and LTC4 production to the level obtained by activation of BMMCs maintained in IL-3 alone with an IC50 of approximately 0.2 ng/ml. IL-4 inhibited the KL-induced increase in expression of cytosolic phospholipase A2 (cPLA2) but had no effect on the incremental expression of PG endoperoxide synthase 1 (PGHS-1) and hematopoietic PGD2 synthase or on the continued baseline expression of 5-lipoxygenase, 5-lipoxygenase activating protein, and LTC4 synthase. BMMCs stimulated by KL + IL-10 for 10 h exhibited a delayed phase of PGD2 generation, which was dependent on de novo induction of PGHS-2. IL-4 inhibited the induction of PGHS-2 expression and the accompanying cytokine-initiated delayed PGD2 generation with an IC50 of approximately 6 ng/ml. IL-4 had no effect on the expression of PGHS-2 and the production of PGD2 elicited by addition of IL-1 beta to the combination of KL + IL-10. IL-4 had no effect on the immediate phase of eicosanoid synthesis elicited by KL alone or by IgE and antigen in BMMCs maintained in IL-3. Thus, the counterregulatory action of IL-4 on eicosanoid generation is highly selective for the induced incremental expression of cPLA2 and the de novo expression of PGHS-2, thereby attenuating time-dependent cytokine-regulated responses to stimulation via Fc epsilon receptor I and stimulation via c-kit, respectively.
Resumo:
The induction of arthritis in DBA/1 mice usually requires immunization with the antigen type II collagen emulsified with Mycobacterium tuberculosis in oil. Here we describe that interleukin 12 (IL-12) can replace mycobacteria and cause severe arthritis of DBA/1 mice when administered in combination with type II collagen. Immunization of DBA/1 mice with type II collagen emulsified in oil alone resulted in a weak immune response, and only a few animals (10-30%) developed arthritis. Administration of IL-12 for 5 days simultaneously with each immunization strongly enhanced the anti-type II collagen immune response. Collagen-specific interferon gamma (IFN-gamma) synthesis by ex vivo activated spleen cells was enhanced 3- to 10-fold. IFN-gamma was almost completely produced by CD4+ T cells. Furthermore, the production of collagen-specific IgG2a and IgG2b antibodies was upregulated 10- to 100-fold. As a consequence, the incidence of arthritis in the group of mice immunized with collagen plus IL-12 was very high (80-100%). The developing arthritis was severe, involving approximately 50% of all limbs with strongly increased footpad thickness in most cases. Furthermore, histological examination revealed massive, mainly polymorphonuclear cell infiltration, synovial hyperplasia, cartilage and bone destruction, as well as new bone formation. In many cases, this resulted in the complete loss of joint structure. Neutralization of IFN-gamma in vivo prevented the development of arthritis in collagen-immunized and IL-12-treated mice. In conclusion, our data show that in vivo administered IL-12 can profoundly upregulate a T helper I-type autoimmune response, resulting in severe joint disease in DBA/1 mice.
Resumo:
Cancer vaccines genetically engineered to produce interleukin 2 have been investigated intensively in a series of animal models and are at the point of entering into clinical trials. In this study we demonstrate a strong correlation between the rate of interleukin 2 production and the protection efficiency of murine S91 melanoma cell (clone M-3) vaccines. Best immunization is achieved with vaccines producing medium interleukin 2 levels of 1000-3000 units per 10(5) cells per day. Reduced interleukin 2 production evokes a corresponding decline in the number of successfully treated animals. Unexpectedly, when interleukin 2 expression is raised to high levels of 5000-7500 units per 10(5) cells per day, protection is completely absent because of impaired generation of tumor-specific cytotoxic T lymphocytes. In comparison, granulocyte-macrophage colony-stimulating factor as immunomodulator induces substantial immunization even at a moderate level of secretion and protects all animals at the maximal obtainable level of secretion. Our findings demonstrate the importance of the interleukin 2 level produced by genetically modified tumor cells and may have substantial impact for the clinical application of cancer vaccines.
Resumo:
A systematic evaluation of structure-activity information led to the construction of genetically engineered interleukin 3 (IL-3) receptor agonists (synthokines) with enhanced hematopoietic potency. SC-55494, the most extensively characterized member of this series, exhibits 10- to 20-fold greater biological activity than recombinant human IL-3 (rhIL-3) in human hematopoietic cell proliferation and marrow colony-forming-unit assays. In contrast, SC-55494 is only twice as active as rhIL-3 in priming the synthesis of inflammatory mediators such as leukotriene C4 and triggering the release of histamine from peripheral blood leukocytes. The enhanced hematopoietic activity of SC-55494 correlates with a 60-fold increase in IL-3 alpha-subunit binding affinity and a 20-fold greater affinity for binding to alpha/beta receptor complexes on intact cells relative to rhIL-3. SC-55494 demonstrates a 5- to 10-fold enhanced hematopoietic response relative to its ability to activate the priming and release of inflammatory mediators. Therefore, SC-55494 may ameliorate the myeloablation of cancer therapeutic regimens while minimizing dose-limiting inflammatory side effects.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.