79 resultados para regulatory elements
Resumo:
Several families of putative transposable elements (TrEs) in both solanaceous plants and Caenorhabditis elegans have been identified by screening the DNA data base for inverted repeated domains present in multiple copies in the genome. The elements are localized within intron and flanking regions of many genes. These elements consist of two inverted repeats flanking sequences ranging from 5 bp to > 500 bp. Identification of multiple elements in which sequence conservation includes both the flanking and internal regions implies that these TrEs are capable of duplicative transposition. Two of the elements were identified in promoter regions of the tomato (Lycoperiscon esculentum) polygalacturonase and potato (Solanum tuberosum) Win1 genes. The element in the polygalacturonase promoter spans a known regulatory region. In both cases, ancestral DNA sequences, which represent potential recombination target sequences prior to insertion of the elements, have been cloned from related species. The sequences of the inverted repeated domains in plants and C. elegans show a high degree of phylogenetic conservation. While frequency of the different elements is variable, some are present in very high copy number. A member of a single C. elegans TrE family is observed approximately once every 20 kb in the genome. The abundance of the described TrEs suggests utility in the genomic analysis of these and related organisms.
Resumo:
Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.
Resumo:
Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.