Ceramide-binding and activation defines protein kinase c-Raf as a ceramide-activated protein kinase.

Interleukin 1 is the prototype of an inflammatory cytokine, and evidence suggests that it uses the sphingomyelin pathway and ceramide production to trigger mitogen-activated protein kinase (MAPK) activation and subsequent gene expression required for acute inflammatory processes. To identify downstream signaling targets of ceramide, a radioiodinated photoaffinity labeling analog of ceramide ([125I] 3-trifluoromethyl-3-(m-iodophenyl)diazirine-ceramide) was employed. It is observed that ceramide specifically binds to and activates protein kinase c-Raf, leading to a subsequent activation of the MAPK cascade. Ceramide does not bind to any other member of the MAPK module nor does it bind to protein kinase C-zeta. These data identify protein kinase c-Raf as a specific molecular target for interleukin 1 beta-stimulated ceramide formation and demonstrate that ceramide is a lipid cofactor participating in regulation of c-Raf activity.

Crystal structure at 2.6-A resolution of human macrophage migration inhibitory factor.

Macrophage migration inhibitory factor (MIF) was the first cytokine to be described, but for 30 years its role in the immune response remained enigmatic. In recent studies, MIF has been found to be a novel pituitary hormone and the first protein identified to be released from immune cells on glucocorticoid stimulation. Once secreted, MIF counterregulates the immunosuppressive effects of steroids and thus acts as a critical component of the immune system to control both local and systemic immune responses. We report herein the x-ray crystal structure of human MIF to 2.6 angstrom resolution. The protein is a trimer of identical subunits. Each monomer contains two antiparallel alpha-helices that pack against a four-stranded beta-sheet. The monomer has an additional two beta-strands that interact with the beta-sheets of adjacent subunits to form the interface between monomers. The three beta-sheets are arranged to form a barrel containing a solvent-accessible channel that runs through the center of the protein along a molecular 3-fold axis. Electrostatic potential maps reveal that the channel has a positive potential, suggesting that it binds negatively charged molecules. The elucidated structure for MIF is unique among cytokines or hormonal mediators, and suggests that this counterregulator of glucocorticoid action participates in novel ligand-receptor interactions.

Elevated interleukin 6 is induced by prostaglandin E2 in a murine model of inflammation: possible role of cyclooxygenase-2.

Injection of mineral oils such as pristane into the peritoneal cavities of BALB/c mice results in a chronic peritonitis associated with high tissue levels of interleukin 6 (IL-6). Here we show that increased prostaglandin E2 (PGE2) synthesis causes induction of IL-6 and that expression of an inducible cyclooxygenase, Cox-2, may mediate this process. Levels of both PGE2 and IL-6 are elevated in inflammatory exudates from pristane-treated mice compared with lavage samples from untreated mice. The Cox-2 gene is induced in the peritoneal macrophage fraction isolated from the mice. A cause and effect relationship between increased macrophage PGE2 and IL-6 production is shown in vitro. When peritoneal macrophages are activated with an inflammatory stimulus (polymerized albumin), the Cox-2 gene is induced and secretion of PGE2 and IL-6 increases, with elevated PGE2 appearing before IL-6. Cotreatment with 1 microM indomethacin inhibits PGE2 production by the cells and reduces the induction of IL-6 mRNA but has no effect on Cox-2 mRNA, consistent with the fact that the drug inhibits catalytic activity of the cyclooxygenase but does not affect expression of the gene. Addition of exogenous PGE2 to macrophages induces IL-6 protein and mRNA synthesis, indicating that the eicosanoid stimulates IL-6 production at the level of gene expression. PGE2-stimulated IL-6 production is unaffected by addition of indomethacin. Taken together with the earlier finding that indomethacin diminishes the elevation of IL-6 in pristane-treated mice, the results show that PGE2 can induce IL-6 production in vivo and implicate expression of the Cox-2 gene in the regulation of this cytokine.

Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.

Baculovirus inhibitors of apoptosis (IAPs) act in insect cells to prevent cell death. Here we describe three mammalian homologs of IAP, MIHA, MIHB, and MIHC, and a Drosophila IAP homolog, DIHA. Each protein bears three baculovirus IAP repeats and an N-terminal ring finger motif. Apoptosis mediated by interleukin 1beta converting enzyme (ICE), which can be inhibited by Orgyia pseudotsugata nuclear polyhedrosis virus IAP (OpIAP) and cowpox virus crmA, was also inhibited by MIHA and MIHB. As MIHB and MIHC were able to bind to the tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 in yeast two-hybrid assays, these results suggest that IAP proteins that inhibit apoptosis may do so by regulating signals required for activation of ICE-like proteases.

Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Retinoblastoma protein directly interacts with and activates the transcription factor NF-IL6.

The biological function of the retinoblastoma protein (RB) in the cell division cycle has been extensively documented, but its apparent role in differentiation remains largely unexplored. To investigate how RB is involved in differentiation, the U937 large-cell lymphoma line was induced to differentiate along a monocyte/macrophage lineage. During differentiation RB was found to interact directly through its simian virus 40 large tumor antigen (T antigen)-binding domain with NF-IL6, a member of the CAAT/enhancer-binding protein (C/EBP) family of transcription factors. NF-IL6 utilizes two distinct regions to bind to the hypophosphorylated form of RB in vitro and in cells. Wild-type but not mutant RB enhanced both binding activity of NF-IL6 to its cognate DNA sequences in vitro and promoter transactivation by NF-IL6 in cells. These findings indicate a novel biochemical function of RB: it activates, by an apparent chaperone-like activity, specific transcription factors important for differentiation. This contrasts with its sequestration and inactivation of other transcription factors, such as E2F-1, which promote progression of the cell cycle. Such disparate mechanisms may help to explain the dual role of RB in cell differentiation and the cell division cycle.

Evidence of autocrine modulation of macrophage nitric oxide synthase by alpha-melanocyte-stimulating hormone.

alpha-Melanocyte-stimulating hormone (alpha-MSH) is a potent inhibitory agent in all major forms of inflammation. To identify a potential mechanism of antiinflammatory action of alpha-MSH, we tested its effects on production of nitric oxide (NO), believed to be a mediator common to all forms of inflammation. We measured NO and alpha-MSH production in RAW 264.7 cultured murine macrophages stimulated with bacterial lipopolysaccharide and interferon gamma. alpha-MSH inhibited production of NO, as estimated from nitrite production and nitration of endogenous macrophage proteins. This occurred through inhibition of production of NO synthase II protein; steady-state NO synthase II mRNA abundance was also reduced. alpha-MSH increased cAMP accumulation in RAW cells, characteristic of alpha-MSH receptors in other cell types. RAW cells also expressed mRNA for the primary alpha-MSH receptor (melanocortin 1). mRNA for proopiomelanocortin, the precursor molecular of alpha-MSH, was expressed in RAW cells, and tumor necrosis factor alpha increased production and release of alpha-MSH. These results suggest that the proinflammatory cytokine tumor necrosis factor alpha can induce macrophages to increase production of alpha-MSH, which then becomes available to act upon melanocortin receptors on the same cells. Such stimulation of melanocortin receptors could modulate inflammation by inhibiting the production of NO. The results suggest that alpha-MSH is an autocrine factor in macrophages which modulates inflammation by counteracting the effects of proinflammatory cytokines.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Inflammation-induced recombinant protein expression in vivo using promoters from acute-phase protein genes.

We report that promoters for two murine acute-phase protein (APP) genes, complement factor 3 (C3) and serum amyloid A3 (SAA3), can increase recombinant protein expression in response to inflammatory stimuli in vivo. To deliver APP promoter-luciferase reporter gene constructs to the liver, where most endogenous APP synthesis occurs, we introduced them into a nonreplicating adenovirus vector and injected the purified viruses intravenously into mice. When compared with the low levels of basal luciferase expression observed prior to inflammatory challenge, markedly increased expression from the C3 promoter was detected in liver in response to both lipopolysaccharide (LPS) and turpentine, and lower-level inducible expression was also found in lung. In contrast, expression from the SAA3 promoter was found only in liver and was much more responsive to LPS than to turpentine. After LPS challenge, hepatic luciferase expression increased rapidly and in proportion to the LPS dose. Use of cytokine-inducible promoters in gene transfer vectors may make it possible to produce antiinflammatory proteins in vivo in direct relationship to the intensity and duration of an individual's inflammatory response. By providing endogenously controlled production of recombinant antiinflammatory proteins, this approach might limit the severity of the inflammatory response without interfering with the beneficial components of host defense and immunity.

Angiogenic properties of human immunodeficiency virus type 1 Tat protein.

Extracellular human immunodeficiency virus type 1 (HIV-1) Tat protein promotes growth of spindle cells derived from AIDS-associated Kaposi sarcoma (AIDS-KS), an angioproliferative disease very frequent in HIV-1-infected individuals. Normal vascular cells, progenitors of AIDS-KS cells, proliferate in response to Tat after exposure to inflammatory cytokines, whose levels are augmented in HIV-1-infected individuals and in KS lesions. Here we show that Tat also promotes AIDS-KS and normal vascular cells to migrate and to degrade the basement membrane and stimulates endothelial cell morphogenesis on a matrix substrate. These effects are obtained at picomolar concentrations of exogenous Tat and are promoted by the treatment of the cells with the same inflammatory cytokines stimulating expression of the receptors for Tat, the integrins alpha 5 beta 1 and alpha v beta 3. Thus, under specific circumstances, Tat has angiogenic properties. As Tat and its receptors are present in AIDS-KS lesions, these data may explain some of the mechanisms by which Tat can induce angiogenesis and cooperate in the development of AIDS-KS.

Surfactant protein a promotes attachment of Mycobacterium tuberculosis to alveolar macrophages during infection with human immunodeficiency virus.

The incidence of tuberculosis is increasing on a global scale, in part due to its strong association with human immunodeficiency virus (HIV) infection. Attachment of Mycobacterium tuberculosis to its host cell, the alveolar macrophage (AM), is an important early step in the pathogenesis of infection. Bronchoalveolar lavage of HIV-infected individuals demonstrated the presence of a factor which significantly enhances the attachment of tubercle bacilli to AMs 3-fold relative to a normal control population. This factor is surfactant protein A (SP-A). SP-A levels are increased in the lungs of HIV-infected individuals. SP-A levels and attachment of M. tuberculosis to AMs inversely correlate with peripheral blood CD4 lymphocyte counts. Elevated concentrations of SP-A during the progression of HIV infection may represent an important nonimmune risk factor for acquiring tuberculosis, even before significant depletion of CD4 lymphocytes in the peripheral blood occurs.

Transendothelial migration of neutrophils involves integrin-associated protein (CD47).

Inflammation is a primary pathological process. The development of an inflammatory reaction involves the movement of white blood cells through the endothelial lining of blood vessels into tissues. This process of transendothelial cell migration of neutrophils has been shown to involve neutrophil beta 2 integrins (CD18) and endothelial cell platelet-endothelium cell adhesion molecules (PECAM-1; CD31). We now show that F(ab')2 fragments of the monoclonal antibody B6H12 against integrin-associated protein (IAP) blocks the transendothelial migration of neutrophils stimulated by an exogenous gradient of the chemokine interleukin 8 (IL-8; 60% inhibition), by the chemotactic peptide N-formyl-methionylleucylphenylalanine (FMLP; 76% inhibition), or by the activation of the endothelium by the cytokine tumor necrosis factor alpha (98% inhibition). The antibody has two mechanisms of action: on neutrophils it prevents the chemotactic response to IL-8 and FMLP, and on endothelium it prevents an unknown but IL-8-independent process. Blocking antibodies to IAP do not alter the expression of adhesion proteins or production of IL-8 by endothelial cells, and thus the inhibition of neutrophil transendothelial migration is selective. These data implicate IAP as the third molecule essential for neutrophil migration through endothelium into sites of inflammation.

Expression cloning of dSR-CI, a class C macrophage-specific scavenger receptor from Drosophila melanogaster.

Mammalian class A macrophage-specific scavenger receptors (SR-A) exhibit unusually broad binding specificity for a wide variety of polyanionic ligands. The properties of these receptors suggest that they may be involved in atherosclerosis and host defense. We have previously observed a similar receptor activity in Drosophila melanogaster embryonic macrophages and in the Drosophila macrophage-like Schneider L2 cell line. Expression cloning was used to isolate from L2 cells a cDNA that encodes a third class (class C) of scavenger receptor, Drosophila SR-CI (dSR-CI). dSR-CI expression was restricted to macrophages/hemocytes during embryonic development. When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation. Although the broad polyanionic ligand-binding specificity of dSR-CI was similar to that of SR-A, their predicted protein sequences are not similar. dSR-CI is a 609-residue type I integral membrane protein containing several well-known sequence motifs, including two complement control protein (CCP) domains and somatomedin B, MAM, and mucin-like domains. Macrophage scavenger receptors apparently mediate important, well-conserved functions and may be pattern-recognition receptors that arose early in the evolution of host-defense mechanisms. Genetic and physiologic analysis of dSR-CI function in Drosophila should provide further insights into the roles played by scavenger receptors in host defense and development.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.