66 resultados para interferon regulatory factor 6


Relevância:

40.00% 40.00%

Publicador:

Resumo:

The expression of the cell adhesion molecules ICAM-1, ICAM-2, and VCAM-1 and the secretion of the cytokine interleukin 6 have been measured in mouse Sertoli cells cultured in vitro. Cytometric analysis revealed that, in basal conditions, low levels of ICAM-1 and VCAM-1 were present on the surface of the cells, whereas treatment with interleukin 1, tumor necrosis factor alpha, lipopolysaccharide, or interferon gamma induced, with different kinetics, increases in their expression. ICAM-2 was not detectable in basal conditions, nor was it inducible. Electron microscopic analysis and binding experiments using 51Cr-labeled lymphocytes demonstrated that increased expression of ICAM-1 and VCAM-1 on the surface of Sertoli cells, induced by inflammatory mediators, determines an augmented adhesion between the two cell types. The same stimuli, with the exception of interferon gamma, produced a rapid and remarkable increment of interleukin 6 production by Sertoli cells. These results suggest the presence of both direct and paracrine mechanisms of interaction between Sertoli and immune-competent cells, possibly involved in the control of immune reactions in the testis. Such mechanisms are of interest for the understanding of autoimmune pathologies of the testis and, if confirmed in humans, they could be involved in the sexual transmission of human immunodeficiency virus infection.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Genes containing the interferon-stimulated response element (ISRE) enhancer have been characterized as transcriptionally responsive primarily to type I interferons (IFN alpha/beta). Induction is due to activation of a multimeric transcription factor, interferon-stimulated gene factor 3 (ISGF3), which is activated by IFN alpha/beta but not by IFN gamma. We found that ISRE-containing genes were induced by IFN gamma as well as by IFN alpha in Vero cells. The IFN gamma response was dependent on the ISRE and was accentuated by preexposure of cells to IFN alpha, a treatment that increases the abundance of ISGF3 components. Overexpression of ISGF3 polypeptides showed that the IFN gamma response depended on the DNA-binding protein ISGF3 gamma (p48) as well as on the 91-kDa protein STAT91 (Stat1 alpha). The transcriptional response to IFN alpha required the 113-kDa protein STAT113 (Stat2) in addition to STAT91 and p48. Mutant fibrosarcoma cells deficient in each component of ISGF3 were used to confirm that IFN gamma induction of an ISRE reporter required p48 and STAT91, but not STAT113. A complex containing p48 and phosphorylated STAT91 but lacking STAT113 bound the ISRE in vitro. IFN gamma-induced activation of this complex, preferentially formed at high concentrations of p48 and STAT91, may explain some of the overlapping responses to IFN alpha and IFN gamma.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Interferon alpha induction of transcription operates through interferon-stimulated-gene factor 3 (ISGF), a transcription factor two components of which are members of the newly characterized Stat family of transcription factors. Interferon alpha induces tyrosine phosphorylation of Stat1 and Stat2 proteins that associate and, together with a 48-kDa protein, form ISGF3. Evidence is presented that a heterodimer of Stat1 and Stat2 is present in ISGF3 and that Stat1 and the 48-kDa protein make precise contact, while Stat2 makes general contact, with the interferon-stimulated response element, the binding site of the ISGF3.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.