66 resultados para human fibroblasts
Resumo:
Thrombin receptor activation was explored in human epidermal keratinocytes and human dermal fibroblasts, cells that are actively involved in skin tissue repair. The effects of thrombin, trypsin, and the receptor agonist peptides SFLLRN and TFRIFD were assessed in inositolphospholipid hydrolysis and calcium mobilization studies. Thrombin and SFLLRN stimulated fibroblasts in both assays to a similar extent, whereas TFRIFD was less potent. Trypsin demonstrated weak efficacy in these assays in comparison with thrombin. Results in fibroblasts were consistent with human platelet thrombin receptor activation. Keratinocytes, however, exhibited a distinct profile, with trypsin being a far better activator of inositolphospholipid hydrolysis and calcium mobilization than thrombin. Furthermore, SFLLRN was more efficacious than thrombin, whereas no response was observed with TFRIFD. Since our data indicated that keratinocytes possess a trypsin-sensitive receptor, we addressed the possibility that these cells express the human homologue of the newly described murine protease-activated receptor, PAR-2 [Nystedt, S., Emilsson, K., Wahlestedt, C. & Sundelin, J. (1994) Proc. Natl. Acad. Sci. USA 91, 9208-9212]. PAR-2 is activated by nanomolar concentrations of trypsin and possesses the tethered ligand sequence SLIGRL. SLIGRL was found to be equipotent with SFLLRN in activating keratinocyte inositolphospholipid hydrolysis and calcium mobilization. Desensitization studies indicated that SFLLRN, SLIGRL, and trypsin activate a common receptor, PAR-2. Northern blot analyses detected a transcript of PAR-2 in total RNA from keratinocytes but not fibroblasts. Levels of thrombin receptor message were equivalent in the two cell types. Our results indicate that human keratinocytes possess PAR-2, suggesting a potential role for this receptor in tissue repair and/or skin-related disorders.
Resumo:
Normal somatic cells invariably enter a state of irreversibly arrested growth and altered function after a finite number of divisions. This process, termed replicative senescence, is thought to be a tumor-suppressive mechanism and an underlying cause of aging. There is ample evidence that escape from senescence, or immortality, is important for malignant transformation. By contrast, the role of replicative senescence in organismic aging is controversial. Studies on cells cultured from donors of different ages, genetic backgrounds, or species suggest that senescence occurs in vivo and that organismic lifespan and cell replicative lifespan are under common genetic control. However, senescent cells cannot be distinguished from quiescent or terminally differentiated cells in tissues. Thus, evidence that senescent cells exist and accumulate with age in vivo is lacking. We show that several human cells express a beta-galactosidase, histochemically detectable at pH 6, upon senescence in culture. This marker was expressed by senescent, but not presenescent, fibroblasts and keratinocytes but was absent from quiescent fibroblasts and terminally differentiated keratinocytes. It was also absent from immortal cells but was induced by genetic manipulations that reversed immortality. In skin samples from human donors of different age, there was an age-dependent increase in this marker in dermal fibroblasts and epidermal keratinocytes. This marker provides in situ evidence that senescent cells may exist and accumulate with age in vivo.
Resumo:
We investigated whether mutations in the p53 tumor suppressor gene alter UV sensitivity and/or repair of UV-induced DNA damage in primary human skin fibroblasts from patients with Li-Fraumeni syndrome, heterozygous for mutations in one allele of the p53 gene (p53 wt/mut) and sublines expressing only mutant p53 (p53 mut). The p53 mut cells were more resistant than the p53 wt/mut cells to UV cytotoxicity and exhibited less UV-induced apoptosis. DNA repair analysis revealed reduced removal of cyclobutane pyrimidine dimers from overall genomic DNA in vivo in p53 mut cells compared with p53 wt/mut or normal cells. However, p53 mut cells retained the ability to preferentially repair damage in the transcribed strands of expressed genes (transcription-coupled repair). These results suggest that loss of p53 function may lead to greater genomic instability by reducing the efficiency of DNA repair but that cellular resistance to DNA-damaging agents may be enhanced through elimination of apoptosis.
Resumo:
The p53 tumor-suppressor protein binds DNA and activates the expression of a 21-kDa protein that inhibits both the activity of cyclin-dependent kinases and the function of proliferating cell nuclear antigen. Since p21 expression has been reported to increase 10- to 20-fold as human diploid fibroblasts lose the ability to replicate, we examined the expression and activity of p53 during replicative aging. Similar levels of total p53 mRNA and protein were expressed in low-passage (young) and high-passage (old) cells but both DNA binding activity in vitro and transcriptional activity of p53 in vivo were increased severalfold in high-passage cells. While the basis of increased p53 activity is presently unclear, it is not correlated with differential phosphorylation or changes in p53-mouse double minute 2 gene product interactions. These results provide evidence for the activation of a protein involved in the control of cell cycle checkpoints during cellular aging, in the absence of increased expression.
Resumo:
We have examined whether the secretion of erythropoietin (Epo) from genetically modified cells could represent an alternative to repeated injections of the recombinant hormone for treating chronic anemias responsive to Epo. Primary mouse skin fibroblasts were transduced with a retroviral vector in which the murine Epo cDNA is expressed under the control of the murine phosphoglycerate kinase promoter. "Neo-organs" containing the genetically modified fibroblasts embedded into collagen lattices were implanted into the peritoneal cavity of mice. Increased hematocrit (> 80%) and elevated serum Epo concentration (ranging from 60 to 408 milliunits/ml) were observed in recipient animals over a 10-month observation period. Hematocrit values measured in recipient mice varied according to the number of implanted Epo-secreting fibroblasts (ranging from 2.5 to 20 x 10(6)). The implantation of neo-organs containing Epo-secreting fibroblasts appeared, therefore, as a convenient method to achieve permanent in vivo delivery of the hormone. We estimated that the biological efficacy of the approach may be relevant for the treatment of human hemoglobinopathies.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.