Apoptosis induced in Jurkat cells by several agents is preceded by intracellular acidification.

We have previously shown that in neutrophils deprived of granulocyte colony-stimulating factor, apoptosis is preceded by acidification and that the protection against apoptosis conferred on neutrophils by granulocyte colony-stimulating factor is dependent upon delay of this acidification. To test the hypothesis that acidification could be a general feature of apoptosis, we examined intracellular pH changes in another cell line. Jurkat cells, a T-lymphoblastoid line, were induced to undergo apoptosis with anti-Fas IgM, cycloheximide, or exposure to short-wavelength UV light. We found that acidification occurred in response to treatment with these agents and that acidification preceded DNA fragmentation. Jurkat cells were also found to possess an acid endonuclease that is active below pH 6.8, compatible with a possible role for this enzyme in chromatin digestion during apoptosis. Incubation of the cells with the bases imidazole or chloroquine during treatment with anti-Fas antibody or cycloheximide or after UV exposure decreased apoptosis as assessed by nuclear morphology and DNA content. The alkalinizing effect of imidazole and chloroquine was shown by the demonstration that the percentage of cells with an intracellular pH below 6.8 after treatment with anti-Fas antibody, cycloheximide, or UV was diminished in the presence of base as compared with similarly treated cells incubated in the absence of base. We conclude that acidification is an early event in programmed cell death and may be essential for genome destruction.

CD38 ligation induces tyrosine phosphorylation of Bruton tyrosine kinase and enhanced expression of interleukin 5-receptor alpha chain: synergistic effects with interleukin 5.

Mouse CD38 has been implicated in the regulation of both B-cell proliferation and protection of B cells from irradiation-induced apoptosis. CD38 ligation on B cells by CS/2, an anti-mouse CD38 monoclonal antibody, induced proliferation, IgM secretion, and tyrosine phosphorylation of Bruton tyrosine kinase in B cells from wild-type mice. B cells from X chromosome-linked immunodeficient mice did not respond at all to anti-CD38 antibody, although CD38 expression on these B cells was comparable to that on wild-type B cells. We infer from these results that Bruton tyrosine kinase activation is involved in B-cell triggering after cross-linkage of CD38. Analysis of the synergistic effects of various cytokines with CD38 ligation on B-cell activation revealed that interleukin 5 (IL-5) showed the most potent effect on B-cell proliferation, Blimp1 gene expression, and IgM production. These synergistic effects were not seen with B cells from X chromosome-linked immunodeficient mice. Flow cytometry analysis revealed that CD38 ligation increased surface expression of the IL-5-receptor alpha chain on B cells. These data indicate that CD38 ligation increases IL-5 receptor alpha expression and synergizes with IL-5 to enhance Blimp1 expression and IgM synthesis.

A Fas-associated protein factor, FAF1, potentiates Fas-mediated apoptosis.

Fas, a member of the tumor necrosis factor receptor family, can induce apoptosis when activated by Fas ligand binding or anti-Fas antibody crosslinking. Genetic studies have shown that a defect in Fas-mediated apoptosis resulted in abnormal development and function of the immune system in mice. A point mutation in the cytoplasmic domain of Fas (a single base change from T to A at base 786), replacing isoleucine with asparagine, abolishes the signal transducing property of Fas. Mice homozygous for this mutant allele (lprcg/lprcg mice) develop lymphadenopathy and a lupus-like autoimmune disease. Little is known about the mechanism of signal transduction in Fas-mediated apoptosis. In this study, we used the two-hybrid screen in yeast to isolate a Fas-associated protein factor, FAF1, which specifically interacts with the cytoplasmic domain of wild-type Fas but not the lprcg-mutated Fas protein. This interaction occurs not only in yeast but also in mammalian cells. When transiently expressed in L cells, FAF1 potentiated Fas-induced apoptosis. A search of available DNA and protein sequence data banks did not reveal significant homology between FAF1 and known proteins. Therefore, FAF1 is an unusual protein that binds to the wild type but not the inactive point mutant of Fas. FAF1 potentiates Fas-induced cell killing and is a candidate signal transducing molecule in the regulation of apoptosis.

Defective IgE production by SJL mice is linked to the absence of CD4+, NK1.1+ T cells that promptly produce interleukin 4.

SJL mice produce little or no IgE in response to polyclonal stimulation with anti-IgD antibody and fail to express interleukin 4 (IL-4) mRNA in the spleen 5 days after injection of anti-IgD, in contrast to other mouse strains that produce substantial amounts of IgE and IL-4. Because IL-4 is critical in IgE production, the possibility that SJL mice are poor IgE producers because their naive T cells fail to differentiate into IL-4 producers must be seriously considered. IL-4 itself is the principal factor determining that naive T cells develop into IL-4 producers. A major source of IL-4 for such differentiation is a population of CD1-specific CD4+ T cells that express NK1.1. These cells produce IL-4 within 90 min of anti-CD3 injection. T cells from SJL mice fail to produce IL-4 in response to injection of anti-CD3. Similarly, SJL T cells and CD4+ thymocytes do not produce IL-4 in response to acute in vitro stimulation. SJL T cells show a marked deficiency in CD4+ cells that express the surface receptors associated with the NK1.1+ T-cell phenotype. This result indicates that the SJL defect in IgE and IL-4 production is associated with, and may be due to, the absence of the CD4+, NK1.1+ T-cell population.

Th1 CD4+ lymphocytes delete activated macrophages through the Fas/APO-1 antigen pathway.

The Fas/APO-1 cytotoxic pathway plays an important role in the regulation of peripheral immunity. Recent evidence indicates that this regulatory function operates through deletion of activated T and B lymphocytes by CD4+ T cells expressing the Fas ligand. Because macrophages play a key role in peripheral immunity, we asked whether Fas was involved in T-cell-macrophage interactions. Two-color flow cytometry revealed that Fas receptor (FasR) was expressed on resting murine peritoneal macrophages. FasR expression was upregulated after activation of macrophages with cytokines or lipopolysaccharide, although only tumor necrosis factor-alpha rendered macrophages sensitive to anti-FasR antibody-mediated death. To determine the consequence of antigen presentation by macrophages to CD4+ T cells, macrophages were pulsed with antigen and then incubated with either Th1 or Th2 cell lines or clones. Th1, but not Th2, T cells induced lysis of 60-80% of normal macrophages, whereas macrophages obtained from mice with mutations in the FasR were totally resistant to Th1-mediated cytotoxicity. Macrophage cytotoxicity depended upon specific antigen recognition by T cells and was major histocompatibility complex restricted. These findings indicate that, in addition to deletion of activated lymphocytes, Fas plays an important role in deletion of activated macrophages after antigen presentation to Th1 CD4+ T cells. Failure to delete macrophages that constitutively present self-antigens may contribute to the expression of autoimmunity in mice deficient in FasR (lpr) or Fas ligand (gld).

Low density lipoprotein receptor-related protein mediates apolipoprotein E-dependent neurite outgrowth in a central nervous system-derived neuronal cell line.

The epsilon 4 allele of apolipoprotein E (apoE) is a major risk factor for Alzheimer disease, suggesting that apoE may directly influence neurons in the aging brain. Recent data suggest that apoE-containing lipoproteins can influence neurite outgrowth in an isoform-specific fashion. The neuronal mediators of apoE effects have not been clarified. We show here that in a central nervous system-derived neuronal cell line, apoE3 but not apoE4 increases neurite extension. The effect of apoE3 was blocked at low nanomolar concentrations by purified 39-kDa protein that regulates ligand binding to the low density lipoprotein receptor-related protein (LRP). Anti-LRP antibody also completely abolished the neurite-promoting effect of apoE3. Understanding isoform-specific cell biological processes mediated by apoE-LRP interactions in central nervous system neurons may provide insight into Alzheimer disease pathogenesis.

Interleukin 1 beta up-regulates the expression of sulfoglucuronosyl paragloboside, a ligand for L-selectin, in brain microvascular endothelial cells.

Treatment of cultured bovine brain microvascular endothelial cells (BMECs) with interleukin 1 beta (IL-1 beta), an inflammatory cytokine, was shown to induce the accumulation of sulfoglucuronosyl paragloboside (SGPG), a glycolipid bearing the HNK-1 epitope. This resulted in the attachment of a greater number of human lymphocytes to the treated than to the untreated BMEC monolayers. Attachment of human lymphocytes to the IL-1 beta-activated BMEC cells could be blocked either by incubation of the human lymphocytes with an anti-L-selectin antibody or by application of an anti-SGPG antibody to the BMECs. These results suggest that SGPG may act as an important ligand for L-selectin for the regulation of the attachment of activated lymphocytes and their subsequent invasion into the nervous system parenchyma in inflammatory disorders of the central and peripheral nervous systems.

The bacterial colicin active against tumor cells in vitro and in vivo is verotoxin 1.

We have identified verotoxin 1 (VT1) as the active component within an antineoplastic bacteriocin preparation from Escherichia coli HSC10 studied over two decades. Recombinant VT1 can simulate the toxicity of anticancer proteins (ACP), and the antineoplastic activity of ACP (and VT1) was abrogated by treatment with anti-VT1 antibody. Similarly, VT1 mimics the protective effect of ACP in a murine metastatic fibrosarcoma model. Prior immunization with VT1 B subunit prevents the effect of VT1 or ACP in this model. The activity of ACP against a variety of human ovarian cell lines was mimicked by VT1, and multidrug-resistant variants were significantly hypersensitive. Primary ovarian tumors and metastases contain elevated levels of globotriaosylceramide compared with normal ovaries, and overlay of frozen tumor sections showed selective VT binding to tumor tissue and the lumen of invading blood vessels. Our contention that VT1 could provide an additional approach to the management of certain human neoplasms is discussed.

Synergy between T-cell immunity and inhibition of paracrine stimulation causes tumor rejection.

During tumor progression, variants may arise that grow more vigorously. The fate of such variants depends upon the balance between aggressiveness of the variant and the strength of the host immunity. Although enhancing host immunity to cancer is a logical objective, eliminating host factors necessary for aggressive growth of the variant should also be considered. The present study illustrates this concept in the model of a spontaneously occurring, progressively growing variant of an ultraviolet light-induced tumor. The variant produces chemotactic factors that attract host leukocytes and is stimulated in vitro by defined growth factors that can be produced or induced by leukocytes. This study also shows that CD8+ T-cell immunity reduces the rate of tumor growth; however, the variant continues to grow and kills the host. Treatment with a monoclonal anti-granulocyte antibody that counteracts the infiltration of the tumor cell inoculum by non-T-cell leukocytes did not interfere with the CD8+ T-cell-mediated immune response but resulted in rejection of the tumor challenge, indicating a synergy between CD8+ T-cell-mediated immunity and the inhibition of paracrine stimulation.

Polyomavirus VP1 phosphorylation: coexpression with the VP2 capsid protein modulates VP1 phosphorylation in Sf9 insect cells.

The polyomavirus virion has an outer capsid comprised of 72 pentamers of the VP1 protein associated with the minor virion proteins, VP2 and VP3, and the viral minichromosome. To investigate the interaction between VP1 and VP2/VP3, we mapped VP1 phosphorylation sites and assayed VP1 recognition by anti-peptide antibodies after coexpression of VP1 with VP2 or VP3 by using recombinant baculovirus vectors. VP1, expressed either alone or with VP3, was phosphorylated on serine residues, which are not modified during polyomavirus infection of mouse cells. When VP1 was coexpressed with VP2, the nonphysiologic serine phosphorylation of VP1 was decreased, and a tryptic peptide containing Thr-63, a site modified during virus infection of mouse cells, was phosphorylated. An anti-peptide antibody directed against the VP1 BC loop domain containing Thr-63 recognized VP1 expressed alone but not VP1 coexpressed with VP2 or VP3. The change in phosphorylation resulting from coexpression of two structural proteins identifies the potential of the baculovirus system for studying protein-protein interactions and defines a functional role for the VP1-VP2 interaction.

Peptide mimicry of the meningococcal group C capsular polysaccharide.

Sequence analysis of the variable regions of the heavy and light chains of the anti-idiotypic antibody 6F9, which mimics the meningococcal group C capsular polysaccharide (MCP), was performed. The immunogenic site on 6F9 responsible for inducing an anti-MCP antibody response was determined by means of sequence and computer model analysis of these data. Complementarity-determining region 3 (CDR3) was found to be unique in that the sequence tract YRY was exposed on the surface. A synthetic peptide spanning the CDR3 domain was synthesized and complexed to proteosomes (meningococcal group B outer membrane protein). Immunizations of BALB/c mice with the peptide-proteosome complex resulted in a significant anti-MCP antibody response. Immunized mice were protected against infection with a lethal dose of Neisseria meningitidis serogroup C.

Prolactin-immunoglobulin G complexes from human serum act as costimulatory ligands causing proliferation of malignant B lymphocytes.

Several lines of evidence indicate that immunoglobulin-bound prolactin found in human serum is not a conventional complex between an anti-prolactin antibody and prolactin but a different type of association of prolactin with the Fab portion of IgG heavy chains. The complex of prolactin with IgG was purified from serum by anti-human prolactin affinity chromatography and was shown to contain close to 1 mole of N epsilon-(gamma-glutamyl)lysine crosslinks per mole of complex, a characteristic feature in structures crosslinked by transglutaminase. Interestingly, the complex caused a proliferation of cells from a subset of patients with chronic lymphocytic leukemia, while it was inactive in a cell proliferation prolactin bioassay. By contrast, human prolactin stimulated the proliferation of cells in the bioassay but had no effect on the complex-responsive cells from the patients. Competition studies with prolactin and free Fc fragment of IgG demonstrated a necessity for engaging both the prolactin and the immunoglobulin receptors for proliferation. More importantly, competition for the growth response by free prolactin and IgG suggests both possible reasons for the slow growth of this neoplasm as well as avenues for control of the disease.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Demonstration of a novel circulating anti-prostacyclin receptor antibody

Although coronary artery disease (CAD) is appreciated to be accelerated in patients with chronic spinal cord injury (SCI), the underlying mechanism of CAD in SCI remains obscure. We have recently shown that platelets from subjects with SCI develop resistance to the inhibitory effect of prostacyclin (PGI2) on the platelet stimulation of thrombin generation. The loss of the inhibitory effect was due to the loss of high-affinity prostanoid receptors, which may contribute to atherogenesis in SCI. Incubation of normal, non-SCI platelets in SCI plasma (n = 12) also resulted in the loss of high-affinity binding of PGI2 (Kd1 = 9.1 ± 2.0 nM; n1 = 170 ± 32 sites per cell vs. Kd1 = 7.2 ± 1.1 nM; n1 = 23 ± 8 sites per cell), with no significant change in the low-affinity receptors (Kd2 = 1.9 ± 0.1 μM; n2 = 1,832 ± 232 sites per cell vs. Kd2 = 1.6 ± 0.1 μM; n2 = 1,740 ± 161 sites per cell) as determined by Scatchard analysis of the binding of [3H]PGE1. The loss of high-affinity PGI2 binding led to the failure of PGI2 to inhibit the platelet-stimulated thrombin generation. The increase of cellular cyclic AMP level, mediated through the binding of PGI2 to low-affinity receptors in platelets, was unaffected in SCI platelets. PAGE and immunoblot of SCI plasma showed the presence of an IgG band, which specifically blocked the binding of [3H]PGE1 to the high-affinity PGI2 receptors of normal platelets. PAGE of the reduced IgG band, the amino acid sequence of the novel band as a heavy chain of IgG that inhibits the binding of [3H]PGE1 to the high-affinity platelet PGI2 receptor, demonstrates that the specific recognition and inhibition of high-affinity PGI2 binding to platelets was due to an anti-prostacyclin receptor antibody present in SCI plasma.

Time-dependent vascular regression and permeability changes in established human tumor xenografts induced by an anti-vascular endothelial growth factor/vascular permeability factor antibody

The hyperpermeability of tumor vessels to macromolecules, compared with normal vessels, is presumably due to vascular endothelial growth factor/vascular permeability factor (VEGF/VPF) released by neoplastic and/or host cells. In addition, VEGF/VPF is a potent angiogenic factor. Removal of this growth factor may reduce the permeability and inhibit tumor angiogenesis. To test these hypotheses, we transplanted a human glioblastoma (U87), a human colon adenocarcinoma (LS174T), and a human melanoma (P-MEL) into two locations in immunodeficient mice: the cranial window and the dorsal skinfold chamber. The mice bearing vascularized tumors were treated with a bolus (0.2 ml) of either a neutralizing antibody (A4.6.1) (492 μg/ml) against VEGF/VPF or PBS (control). We found that tumor vascular permeability to albumin in antibody-treated groups was lower than in the matched controls and that the effect of the antibody was time-dependent and influenced by the mode of injection. Tumor vascular permeability did not respond to i.p. injection of the antibody until 4 days posttreatment. However, the permeability was reduced within 6 h after i.v. injection of the same amount of antibody. In addition to the reduction in vascular permeability, the tumor vessels became smaller in diameter and less tortuous after antibody injections and eventually disappeared from the surface after four consecutive treatments in U87 tumors. These results demonstrate that tumor vascular permeability can be reduced by neutralization of endogenous VEGF/VPF and suggest that angiogenesis and the maintenance of integrity of tumor vessels require the presence of VEGF/VPF in the tissue microenvironment. The latter finding reveals a new mechanism of tumor vessel regression—i.e., blocking the interactions between VEGF/VPF and endothelial cells or inhibiting VEGF/VPF synthesis in solid tumors causes dramatic reduction in vessel diameter, which may block the passage of blood elements and thus lead to vascular regression.