Endogenous mutagenesis by an insertion sequence element identifies Aeromonas salmonicida AbcA as an ATP-binding cassette transport protein required for biogenesis of smooth lipopolysaccharide.

Analysis of an Aeromonas salmonicida A layer-deficient/O polysaccharide-deficient mutant carrying a Tn5 insertion in the structural gene for A protein (vapA) showed that the abcA gene immediately downstream of vapA had been interrupted by the endogenous insertion sequence element ISAS1. Immunoelectron microscopy showed that O polysaccharides did not accumulate at the inner membrane-cytoplasm interface of this mutant. abcA encodes an unusual protein; it carries both an amino-terminal ATP-binding cassette (ABC) domain showing high sequence similarity to ABC proteins implicated in the transport of certain capsular and O polysaccharides and a carboxyl-terminal potential DNA-binding domain, which distinguishes AbcA from other polysaccharide transport proteins in structural and evolutionary terms. The smooth lipopolysaccharide phenotype was restored by complementation with abcA but not by abcA carrying site-directed mutations in the sequence encoding the ATP-binding site of the protein. The genetic organization of the A. salmonicida ABC polysaccharide system differs from other bacteria. abcA also differs in apparently being required for both O-polysaccharide synthesis and in energizing the transport of O polysaccharides to the cell surface.

A dominant-negative mutant of human poly(ADP-ribose) polymerase affects cell recovery, apoptosis, and sister chromatid exchange following DNA damage.

Poly(ADP-ribose) polymerase [PARP; NAD+ ADP-ribosyltransferase; NAD+:poly(adenosine-diphosphate-D-ribosyl)-acceptor ADP-D-ribosyltransferase, EC 2.4.2.30] is a zinc-dependent eukaryotic DNA-binding protein that specifically recognizes DNA strand breaks produced by various genotoxic agents. To study the biological function of this enzyme, we have established stable HeLa cell lines that constitutively produce the 46-kDa DNA-binding domain of human PARP (PARP-DBD), leading to the trans-dominant inhibition of resident PARP activity. As a control, a cell line was constructed, producing a point-mutated version of the DBD, which has no affinity for DNA in vitro. Expression of the PARP-DBD had only a slight effect on undamaged cells but had drastic consequences for cells treated with genotoxic agents. Exposure of cell lines expressing the wild-type (wt) or the mutated PARP-DBD, with low doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) resulted in an increase in their doubling time, a G2 + M accumulation, and a marked reduction in cell survival. However, UVC irradiation had no preferential effect on the cell growth or viability of cell lines expressing the PARP-DBD. These PARP-DBD-expressing cells treated with MNNG presented the characteristic nucleosomal DNA ladder, one of the hallmarks of cell death by apoptosis. Moreover, these cells exhibited chromosomal instability as demonstrated by higher frequencies of both spontaneous and MNNG-induced sister chromatid exchanges. Surprisingly, the line producing the mutated DBD had the same behavior as those producing the wt DBD, indicating that the mechanism of action of the dominant-negative mutant involves more than its DNA-binding function. Altogether, these results strongly suggest that PARP is an element of the G2 checkpoint in mammalian cells.

A peptide interaction in the major groove of RNA resembles protein interactions in the minor groove of DNA.

A 17-amino acid arginine-rich peptide from the bovine immunodeficiency virus Tat protein has been shown to bind with high affinity and specificity to bovine immunodeficiency virus transactivation response element (TAR) RNA, making contacts in the RNA major groove near a bulge. We show that, as in other peptide-RNA complexes, arginine and threonine side chains make important contributions to binding but, unexpectedly, that one isoleucine and three glycine residues also are critical. The isoleucine side chain may intercalate into a hydrophobic pocket in the RNA. Glycine residues may allow the peptide to bind deeply within the RNA major groove and may help determine the conformation of the peptide. Similar features have been observed in protein-DNA and drug-DNA complexes in the DNA minor groove, including hydrophobic interactions and binding deep within the groove, suggesting that the major groove of RNA and minor groove of DNA may share some common recognition features.

Tyrosine-phosphorylated Stat1 and Stat2 plus a 48-kDa protein all contact DNA in forming interferon-stimulated-gene factor 3.

Interferon alpha induction of transcription operates through interferon-stimulated-gene factor 3 (ISGF), a transcription factor two components of which are members of the newly characterized Stat family of transcription factors. Interferon alpha induces tyrosine phosphorylation of Stat1 and Stat2 proteins that associate and, together with a 48-kDa protein, form ISGF3. Evidence is presented that a heterodimer of Stat1 and Stat2 is present in ISGF3 and that Stat1 and the 48-kDa protein make precise contact, while Stat2 makes general contact, with the interferon-stimulated response element, the binding site of the ISGF3.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Promoter architecture in the flagellar regulon of Bacillus subtilis: high-level expression of flagellin by the sigma D RNA polymerase requires an upstream promoter element.

Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.