59 resultados para virulence related-genes


Relevância:

80.00% 80.00%

Publicador:

Resumo:

We have used suspension-cultured parsley cells (Petroselinum crispum) and an oligopeptide elicitor derived from a surface glycoprotein of the phytopathogenic fungus Phytophthora megasperma f.sp. glycinea to study the signaling pathway from elicitor recognition to defense gene activation. Immediately after specific binding of the elicitor by a receptor in the plasma membrane, large and transient increases in several inorganic ion fluxes (Ca2+, H+, K+, Cl-) and H2O2 formation are the first detectable plant cell responses. These are rapidly followed by transient changes in the phosphorylation status of various proteins and by the activation of numerous defense-related genes, concomitant with the inactivation of several other, non-defense-related genes. A great diversity of cis-acting elements and trans-acting factors appears to be involved in elicitor-mediated gene regulation, similar to the apparently complex nature of the signal transduced intracellularly. With few exceptions, all individual defense responses analyzed in fungus-infected parsley leaves have been found to be closely mimicked in elicitor-treated, cultured parsley cells, thus validating the use of the elicitor/cell culture system as a valuable model system for these types of study.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Analysis of several Salmonella typhimurium in vivo-induced genes located in regions of atypical base composition has uncovered acquired genetic elements that cumulatively engender pathogenicity. Many of these regions are associated with mobile elements, encode predicted adhesin and invasin-like functions, and are required for full virulence. Some of these regions distinguish broad host range from host-adapted Salmonella serovars and may contribute to inherent differences in host specificity, tissue tropism, and disease manifestation. Maintenance of this archipelago of acquired sequence by selection in specific hosts reveals a fossil record of the evolution of pathogenic species.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We describe a plant protoplast transformation method that provides transformants with a simple pattern of integration of a foreign gene. The approach is to deliver into plant protoplasts by direct gene transfer the Agrobacterium virulence genes virD1 and virD2 with or without virE2, together with a target plasmid containing a gene of interest flanked by Agrobacterium T-DNA border repeat sequences of 25 bp. We present evidence of T-DNA formation in maize protoplasts and its integration into the maize genome. The frequency of VirD1-VirD2-mediated integration events was about 20–35% of the total number of transformants. The addition of virE2 doubled the transformation efficiency. The method described here is of sufficient efficiency and simplicity to be useful for the production of transgenic plants with single-copy well-defined transgenic inserts.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The study of development has relied primarily on the isolation of mutations in genes with specific functions in development and on the comparison of their expression patterns in normal and mutant phenotypes. Comparative evolutionary analyses can complement these approaches. Phylogenetic analyses of Sonic hedgehog (Shh) and Hoxd-10 genes from 18 cyprinid fish species closely related to the zebrafish provide novel insights into the functional constraints acting on Shh. Our results confirm and extend those gained from expression and crystalline structure analyses of this gene. Unexpectedly, exon 1 of Shh is found to be almost invariant even in third codon positions among these morphologically divergent species suggesting that this exon encodes for a functionally important domain of the hedgehog protein. This is surprising because the main functional domain of Shh had been thought to be that encoded by exon 2. Comparisons of Shh and Hoxd-10 gene sequences and of resulting gene trees document higher evolutionary constraints on the former than on the latter. This might be indicative of more general evolutionary patterns in networks of developmental regulatory genes interacting in a hierarchical fashion. The presence of four members of the hedgehog gene family in cyprinid fishes was documented and their homologies to known hedgehog genes in other vertebrates were established.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The plant pathogenic bacterium Erwinia chrysanthemi secretes pectate lyase proteins that are important virulence factors attacking the cell walls of plant hosts. Bacterial production of these enzymes is induced by the substrate polypectate-Na (NaPP) and further stimulated by the presence of plant extracts. The bacterial regulator responsible for induction by plant extracts was identified and purified by using a DNA-binding assay with the promoter region of pelE that encodes a major pectate lyase. A novel bacterial protein, called Pir, was isolated that produced a specific gel shift of the pelE promoter DNA, and the corresponding pir gene was cloned and sequenced. The Pir protein contains 272 amino acids with a molecular mass of 30 kDa and appears to function as a dimer. A homology search indicates that Pir belongs to the IclR family of transcriptional regulators. Pir bound to a 35-bp DNA sequence in the promoter region of pelE. This site overlaps that of a previously described negative regulator, KdgR. Gel shift experiments showed that the binding of either Pir or KdgR interfered with binding of the other protein.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Mitogen-activated protein (MAP) kinases are pivotal components of eukaryotic signaling cascades. Phosphorylation of tyrosine and threonine residues activates MAP kinases, but either dual-specificity or monospecificity phosphatases can inactivate them. The Candida albicans CPP1 gene, a structural member of the VH1 family of dual- specificity phosphatases, was previously cloned by its ability to block the pheromone response MAP kinase cascade in Saccharomyces cerevisiae. Cpp1p inactivated mammalian MAP kinases in vitro and acted as a tyrosine-specific enzyme. In C. albicans a MAP kinase cascade can trigger the transition from the budding yeast form to a more invasive filamentous form. Disruption of the CPP1 gene in C. albicans derepressed the yeast to hyphal transition at ambient temperatures, on solid surfaces. A hyphal growth rate defect under physiological conditions in vitro was also observed and could explain a reduction in virulence associated with reduced fungal burden in the kidneys seen in a systemic mouse model. A hyper-hyphal pathway may thus have some detrimental effects on C. albicans cells. Disruption of the MAP kinase homologue CEK1 suppressed the morphological effects of the CPP1 disruption in C. albicans. The results presented here demonstrate the biological importance of a tyrosine phosphatase in cell-fate decisions and virulence in C. albicans.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The influenza A virus pandemic of 1918–1919 resulted in an estimated 20–40 million deaths worldwide. The hemagglutinin and neuraminidase sequences of the 1918 virus were previously determined. We here report the sequence of the A/Brevig Mission/1/18 (H1N1) virus nonstructural (NS) segment encoding two proteins, NS1 and nuclear export protein. Phylogenetically, these genes appear to be close to the common ancestor of subsequent human and classical swine strain NS genes. Recently, the influenza A virus NS1 protein was shown to be a type I IFN antagonist that plays an important role in viral pathogenesis. By using the recently developed technique of generating influenza A viruses entirely from cloned cDNAs, the hypothesis that the 1918 virus NS1 gene played a role in virulence was tested in a mouse model. In a BSL3+ laboratory, viruses were generated that possessed either the 1918 NS1 gene alone or the entire 1918 NS segment in a background of influenza A/WSN/33 (H1N1), a mouse-adapted virus derived from a human influenza strain first isolated in 1933. These 1918 NS viruses replicated well in tissue culture but were attenuated in mice as compared with the isogenic control viruses. This attenuation in mice may be related to the human origin of the 1918 NS1 gene. These results suggest that interaction of the NS1 protein with host-cell factors plays a significant role in viral pathogenesis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We describe the isolation of an Arabidopsis gene that is closely related to the animal ZnT genes (Zn transporter). The protein encoded by the ZAT (Zn transporter of Arabidopsis thaliana) gene has 398 amino acid residues and is predicted to have six membrane-spanning domains. To obtain evidence for the postulated function of the Arabidopsis gene, transgenic plants with the ZAT coding sequence under control of the cauliflower mosaic virus 35S promoter were analyzed. Plants obtained with ZAT in the sense orientation exhibited enhanced Zn resistance and strongly increased Zn content in the roots under high Zn exposure. Antisense mRNA-producing plants were viable, with a wild-type level of Zn resistance and content, like plants expressing a truncated coding sequence lacking the C-terminal cytoplasmic domain of the protein. The availability of ZAT can lead to a better understanding of the mechanism of Zn homeostasis and resistance in plants.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Class I isoforms of β-1,3-glucanases (βGLU I) and chitinases (CHN I) are antifungal, vacuolar proteins implicated in plant defense. Tobacco (Nicotiana tabacum L.) βGLU I and CHN I usually exhibit tightly coordinated developmental, hormonal, and pathogenesis-related regulation. Both enzymes are induced in cultured cells and tissues of cultivar Havana 425 tobacco by ethylene and are down-regulated by combinations of the growth hormones auxin and cytokinin. We report a novel pattern of βGLU I and CHN I regulation in cultivar Havana 425 tobacco pith-cell suspensions and cultured leaf explants. Abscisic acid (ABA) at a concentration of 10 μm markedly inhibited the induction of βGLU I but not of CHN I. RNA-blot hybridization and immunoblot analysis showed that only class I isoforms of βGLU and CHN are induced in cell culture and that ABA inhibits steady-state βGLU I mRNA accumulation. Comparable inhibition of β-glucuronidase expression by ABA was observed for cells transformed with a tobacco βGLU I gene promoter/β-glucuronidase reporter gene fusion. Taken together, the results strongly suggest that ABA down-regulates transcription of βGLU I genes. This raises the possibility that some of the ABA effects on plant-defense responses might involve βGLU I.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The whole genome sequence (1.83 Mbp) of Haemophilus influenzae strain Rd was searched to identify tandem oligonucleotide repeat sequences. Loss or gain of one or more nucleotide repeats through a recombination-independent slippage mechanism is known to mediate phase variation of surface molecules of pathogenic bacteria, including H. influenzae. This facilitates evasion of host defenses and adaptation to the varying microenvironments of the host. We reasoned that iterative nucleotides could identify novel genes relevant to microbe-host interactions. Our search of the Rd genome sequence identified 9 novel loci with multiple (range 6-36, mean 22) tandem tetranucleotide repeats. All were found to be located within putative open reading frames and included homologues of hemoglobin-binding proteins of Neisseria, a glycosyltransferase (IgtC gene product) of Neisseria, and an adhesin of Yersinia. These tetranucleotide repeat sequences were also shown to be present in two other epidemiologically different H. influenzae type b strains, although the number and distribution of repeats was different. Further characterization of the IgtC gene showed that it was involved in phenotypic switching of a lipopolysaccharide epitope and that this variable expression was associated with changes in the number of tetranucleotide repeats. Mutation of IgtC resulted in attenuated virulence of H. influenzae in an infant rat model of invasive infection. These data indicate the rapidity, economy, and completeness with which whole genome sequences can be used to investigate the biology of pathogenic bacteria.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Pseudomonas aeruginosa, an opportunistic human pathogen, is a major causative agent of mortality and morbidity in immunocompromised patients and those with cystic fibrosis genetic disease. To identify new virulence genes of P. aeruginosa, a selection system was developed based on the in vivo expression technology (IVET) that was first reported in Salmonella system. An adenine-requiring auxotrophic mutant strain of P. aeruginosa was isolated and found avirulent on neutropenic mice. A DNA fragment that can complement the mutant strain, containing purEK operon that is required for de novo biosynthesis of purine, was sequenced and used in the IVET vector construction. By applying the IVET selection system to a neutropenic mouse infection model, genetic loci that are specifically induced in vivo were identified. Twenty-two such loci were partially sequenced and analyzed. One of them was a well-studied virulence factor, pyochelin receptor (FptA), that is involved in iron acquisition. Fifteen showed significant homology to reported sequences in GenBank, while the remaining six did not. One locus, designated np20, encodes an open reading frame that shares amino acid sequence homology to transcriptional regulators, especially to the ferric uptake regulator (Fur) proteins of other bacteria. An insertional np20 null mutant strain of P. aeruginosa did not show a growth defect on laboratory media; however, its virulence on neutropenic mice was significantly reduced compared with that of a wild-type parent strain, demonstrating the importance of the np20 locus in the bacterial virulence. The successful isolation of genetic loci that affect bacterial virulence demonstrates the utility of the IVET system in identification of new virulence genes of P. aeruginosa.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Microorganisms play an important role in the biogeochemistry of the ocean surface layer, but spatial and temporal structures in the distributions of specific bacterioplankton species are largely unexplored, with the exceptions of those organisms that can be detected by either autofluorescence or culture methods. The use of rRNA genes as genetic markers provides a tool by which patterns in the growth, distribution, and activity of abundant bacterioplankton species can be studied regardless of the ease with which they can be cultured. Here we report an unusual cluster of related 16S rRNA genes (SAR202, SAR263, SAR279, SAR287, SAR293, SAR307) cloned from seawater collected at 250 m in the Sargasso Sea in August 1991, when the water column was highly stratified and the deep chlorophyll maximum was located at a depth of 120 m. Phylogenetic analysis and an unusual 15-bp deletion confirmed that the genes were related to the Green Non-Sulfur phylum of the domain Bacteria. This is the first evidence that representatives of this phylum occur in the open ocean. Oligonucleotide probes were used to examine the distribution of the SAR202 gene cluster in vertical profiles (0-250 m) from the Atlantic and Pacific Oceans, and in discrete (monthly) time series (O and 200 m) (over 30 consecutive months in the Western Sargasso Sea. The data provide robust statistical support for the conclusion that the SAR202 gene cluster is proportionately most abundant at the lower boundary of the deep chlorophyll maximum (P = 2.33 x 10(-5)). These results suggest that previously unsuspected stratification of microbial populations may be a significant factor in the ecology of the ocean surface layer.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The response of the maize catalase genes (Cat1, Cat2, and Cat3) to salicylic acid (SA) was examined at two distinct developmental stages: embryogenesis and germination. A unique, germination-related differential response of each maize catalase gene to various doses of SA was observed. During late embryogenesis, total catalase activity in scutella increased dramatically with 1 mM SA treatment. The accumulation of Cat2 transcript and CAT-2 isozyme protein provided the major contribution to the observed increase in total catalase activity. This increase was paralleled by the enhanced growth of germinated embryos at that stage. In a CAT-2 null mutant line, a full compensation of total catalase activity by the CAT-1 isozyme was observed in the presence of SA. This suggests that catalase is important for maintenance of normal cellular processes under stress conditions. SA at 1 mM, which enhances growth of precociously germinated embryos, appeared to inhibit seed germination at 1 day after inhibition. Furthermore, Cat2 transcript accumulation was inhibited at this stage. SA is probably not a direct signal for the induction of the catalase genes. Other signals, possibly germination-related regulator(s), might be responsible for the induction of the catalase genes. The effect of SA on the activity of purified catalase protein was also examined.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.