The disease-resistance gene Pto and the fenthion-sensitivity gene fen encode closely related functional protein kinases.

Resistance to bacterial speck in tomato is governed by a gene-for-gene interaction in which a single resistance locus (Pto) in the plant responds to the expression of a specific avirulence gene (avrPto) in the pathogen. Disease susceptibility results if either Pto or avrPto are lacking from the corresponding organisms. Leaves of tomato cultivars that contain the Pto locus also exhibit a hypersensitive-like response upon exposure to an organophosphorous insecticide, fenthion. Recently, the Pto gene was isolated by a map-based cloning approach and was shown to be a member of a clustered multigene family with similarity to various protein-serine/threonine kinases. Another member of this family, termed Fen, was found to confer sensitivity to fenthion. The Pto protein shares 80% identity (87% similarity) with Fen. Here, Pto and Fen are shown to be functional protein kinases that probably participate in the same signal transduction pathway.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Horizontal gene transfer among genomes: The complexity hypothesis

Increasingly, studies of genes and genomes are indicating that considerable horizontal transfer has occurred between prokaryotes. Extensive horizontal transfer has occurred for operational genes (those involved in housekeeping), whereas informational genes (those involved in transcription, translation, and related processes) are seldomly horizontally transferred. Through phylogenetic analysis of six complete prokaryotic genomes and the identification of 312 sets of orthologous genes present in all six genomes, we tested two theories describing the temporal flow of horizontal transfer. We show that operational genes have been horizontally transferred continuously since the divergence of the prokaryotes, rather than having been exchanged in one, or a few, massive events that occurred early in the evolution of prokaryotes. In agreement with earlier studies, we found that differences in rates of evolution between operational and informational genes are minimal, suggesting that factors other than rate of evolution are responsible for the observed differences in horizontal transfer. We propose that a major factor in the more frequent horizontal transfer of operational genes is that informational genes are typically members of large, complex systems, whereas operational genes are not, thereby making horizontal transfer of informational gene products less probable (the complexity hypothesis).

Specific association of the gene product of PKD2 with the TRPC1 channel

The function(s) of the genes (PKD1 and PKD2) responsible for the majority of cases of autosomal dominant polycystic kidney disease is unknown. While PKD1 encodes a large integral membrane protein containing several structural motifs found in known proteins involved in cell–cell or cell–matrix interactions, PKD2 has homology to PKD1 and the major subunit of the voltage-activated Ca2+ channels. We now describe sequence homology between PKD2 and various members of the mammalian transient receptor potential channel (TRPC) proteins, thought to be activated by G protein-coupled receptor activation and/or depletion of internal Ca2+ stores. We show that PKD2 can directly associate with TRPC1 but not TRPC3 in transfected cells and in vitro. This association is mediated by two distinct domains in PKD2. One domain involves a minimal region of 73 amino acids in the C-terminal cytoplasmic tail of PKD2 shown previously to constitute an interacting domain with PKD1. However, distinct residues within this region mediate specific interactions with TRPC1 or PKD1. The C-terminal domain is sufficient but not necessary for the PKD2–TRPC1 association. A more N-terminal domain located within transmembrane segments S2 and S5, including a putative pore helical region between S5 and S6, is also responsible for the association. Given the ability of the TRPC to form functional homo- and heteromultimeric complexes, these data provide evidence that PKD2 may be functionally related to TRPC proteins and suggest a possible role of PKD2 in modulating Ca2+ entry in response to G protein-coupled receptor activation and/or store depletion.

Hepatocyte gene therapy in a large animal: A neonatal bovine model of citrullinemia

The development of gene-replacement therapy for inborn errors of metabolism has been hindered by the limited number of suitable large-animal models of these diseases and by inadequate methods of assessing the efficacy of treatment. Such methods should provide sensitive detection of expression in vivo and should be unaffected by concurrent pharmacologic and dietary regimens. We present the results of studies in a neonatal bovine model of citrullinemia, an inborn error of urea-cycle metabolism characterized by deficiency of argininosuccinate synthetase and consequent life-threatening hyperammonemia. Measurements of the flux of nitrogen from orally administered 15NH4 to [15N]urea were used to determine urea-cycle activity in vivo. In control animals, these isotopic measurements proved to be unaffected by pharmacologic treatments. Systemic administration of a first-generation E1-deleted adenoviral vector expressing human argininosuccinate synthetase resulted in transduction of hepatocytes and partial correction of the enzyme defect. The isotopic method showed significant restoration of urea synthesis. Moreover, the calves showed clinical improvement and normalization of plasma glutamine levels after treatment. The results show the clinical efficacy of treating a large-animal model of an inborn error of hepatocyte metabolism in conjunction with a method for sensitively measuring correction in vivo. These studies will be applicable to human trials of the treatment of this disorder and other related urea-cycle disorders.

Loss of the circadian clock-associated protein 1 in Arabidopsis results in altered clock-regulated gene expression

Little is known about plant circadian oscillators, in spite of how important they are to sessile plants, which require accurate timekeepers that enable the plants to respond to their environment. Previously, we identified a circadian clock-associated (CCA1) gene that encodes an Myb-related protein that is associated with phytochrome control and circadian regulation in plants. To understand the role CCA1 plays in phytochrome and circadian regulation, we have isolated an Arabidopsis line with a T DNA insertion that results in the loss of CCA1 RNA, of CCA1 protein, and of an Lhcb-promoter binding activity. This mutation affects the circadian expression of all four clock-controlled genes that we examined. The results show that, despite their similarity, CCA1 and LHY are only partially redundant. The lack of CCA1 also affects the phytochrome regulation of gene expression, suggesting that CCA1 has an additional role in a signal transduction pathway from light, possibly acting at the point of integration between phytochrome and the clock. Our results indicate that CCA1 is an important clock-associated protein involved in circadian regulation of gene expression.

Gene number in an invertebrate chordate, Ciona intestinalis

Gene number can be considered a pragmatic measure of biological complexity, but reliable data is scarce. Estimates for vertebrates are 50-100,000 genes per haploid genome, whereas invertebrate estimates fall below 25,000. We wished to test the hypothesis that the origin of vertebrates coincided with extensive gene creation. A prediction is that gene number will differ sharply between invertebrate and vertebrate members of the chordate phylum. A gene number estimation method requiring limited sequence sampling of genomic DNA was developed and validated by using data for Caenorhabditis elegans. Using the method, we estimated that the invertebrate chordate Ciona intestinalis has 15,500 protein-coding genes (±3,700). This number is significantly lower than gene numbers of vertebrate chordates, but similar to those of invertebrates in distantly related phyla. The data indicate that evolution of vertebrates was accompanied by a dramatic increase in protein-coding capacity of the genome.

Molecular coevolution within a Drosophila clock gene

The period (per) gene in Drosophila melanogaster provides an integral component of biological rhythmicity and encodes a protein that includes a repetitive threonine-glycine (Thr-Gly) tract. Similar repeats are found in the frq and wc2 clock genes of Neurospora crassa and in the mammalian per homologues, but their circadian functions are unknown. In Drosophilids, the length of the Thr-Gly repeat varies widely between species, and sequence comparisons have suggested that the repeat length coevolves with the immediately flanking amino acids. A functional test of the coevolution hypothesis was performed by generating several hybrid per transgenes between Drosophila pseudoobscura and D. melanogaster, whose repetitive regions differ in length by about 150 amino acids. The positions of the chimeric junctions were slightly altered in each transgene. Transformants carrying per constructs in which the repeat of one species was juxtaposed next to the flanking region of the other were almost arrhythmic or showed a striking temperature sensitivity of the circadian period. In contrast, transgenes in which the repeat and flanking regions were conspecific gave wild-type levels of circadian rescue. These results support the coevolutionary interpretation of the interspecific sequence changes in this region of the PER molecule and reveal a functional dimension to this process related to the clock’s temperature compensation.

The gastrulation defective gene of Drosophila melanogaster is a member of the serine protease superfamily

The establishment of dorsal–ventral polarity in the oocyte involves two sets of genes. One set belongs to the gurken-torpedo signaling pathway and affects the development of the egg chorion as well as the polarity of the embryo. The second set of genes affects only the dorsal–ventral polarity of the embryo but not the eggshell. gastrulation defective is one of the earliest acting of this second set of maternally required genes. We have cloned and characterized the gastrulation defective gene and determined that it encodes a protein structurally related to the serine protease superfamily, which also includes the Snake, Easter, and Nudel proteins. These data provide additional support for the involvement of a protease cascade in generating an asymmetric signal (i.e., asymmetric Spätzle activity) during establishment of dorsal–ventral polarity in the Drosophila embryo.

Amyrel, a paralogous gene of the amylase gene family in Drosophila melanogaster and the Sophophora subgenus

We describe a gene from Drosophila melanogaster related to the alpha-amylase gene Amy. This gene, which exists as a single copy, was named Amyrel. It is strikingly divergent from Amy because the amino acid divergence is 40%. The coding sequence is interrupted by a short intron at position 655, which is unusual in amylase genes. Amyrel has also been cloned in Drosophila ananassae, Drosophila pseudoobscura, and Drosophila subobscura and is likely to be present throughout the Sophophora subgenus, but, to our knowledge, it has not been detected outside. Unexpectedly, there is a strong conservation of 5′ and 3′ flanking regions between Amyrel genes from different species, which is not the case for Amy and which suggests that selection acts on these regions. In contrast to the Amy genes, Amyrel is transcribed in larvae of D. melanogaster but not in adults. However, the protein has not been detected yet. Amyrel evolves about twice as fast as Amy in the several species studied. We suggest that this gene could result from a duplication of Amy followed by accelerated and selected divergence toward a new adaptation.