Cellular aging, destabilization, and cancer.

Three major characteristics of aging in animals are a slowdown of cell proliferation, an increase in residual bodies associated with age pigments, and a marked increase in the likelihood of neoplastic transformation. The 28 L subline of the NIH 3T3 line of mouse embryo fibroblasts exhibits all these characteristics when held at confluence for extended periods. The impairment of proliferation is the first behavioral characteristic detected in low density subcultures from the confluent cultures, and it persists through many cell generations of exponential multiplication. There is an equal degree of growth impairment among replicate cultures (lineages) recovered after each of 2 successive rounds of confluence, although heterogeneity appears after the third round. The growth impairment pervades the entire cell population of each lineage. The degree and duration of impairment increase with repeated rounds of confluence. A marked increase of residual bodies characteristic of age pigments occurs in the cytoplasm of all the cells kept under prolonged confluence. Neoplastic transformation first appears as foci of multilayered cells on a monolayered background of nontransformed cells. The transformed cells arise at different times in the lineages and originate from a very small fraction of the population. The transformed cells selectively overgrow the entire population in successive rounds of confluence leading to an increase in saturation density of each lineage at different times. Under cloning conditions, isolated colonies of transformed cells develop more slowly than colonies of nontransformed cells but eventually reach a higher population density. The regularity of persistent growth impairment among the lineages and the appearance of large numbers of residual bodies in all the cells of each population are more characteristic of an epigenetic process than of specific local mutations. although random chromosomal lesions cannot be ruled out. By contrast, the low frequency and stochastic character of neoplastic transformation are consistent with a conventional genetic origin. The advent in long-term confluent NIH 3T3 cultures of three cardinal characteristics of cellular aging in vivo recommends it as a model for aging cells.

Telomere length and replicative aging in human vascular tissues.

Because repeated injury of the endothelium and subsequent turnover of intimal and medial cells have been implicated in atherosclerosis, we examined telomere length, a marker of somatic cell turnover, in cells from these tissues. Telomere lengths were assessed by Southern analysis of terminal restriction fragments (TRFs) generated by HinfI/Rsa I digestion of human genomic DNA. Mean TRF length decreased as a function of population doublings in human endothelial cell cultures from umbilical veins, iliac arteries, and iliac veins. When endothelial cells were examined for mean TRF length as a function of donor age, there was a significantly greater rate of decrease for cells from iliac arteries than from iliac veins (102 bp/yr vs. 47 bp/yr, respectively, P < 0.05), consistent with higher hemodynamic stress and increased cell turnover in arteries. Moreover, the rate of telomere loss as a function of donor age was greater in the intimal DNA of iliac arteries compared to that of the internal thoracic arteries (147 bp/yr vs. 87 bp/yr, respectively, P < 0.05), a region of the arterial tree subject to less hemodynamic stress. This indicates that the effect is not tissue specific. DNA from the medial tissue of the iliac and internal thoracic arteries showed no significant difference in the rates of decrease, suggesting that chronic stress leading to cellular senescence is more pronounced in the intima than in the media. These observations extend the use of telomere size as a marker for the replicative history of cells and are consistent with a role for focal replicative senescence in cardiovascular diseases.

Muscle-specific expression of Drosophila hsp70 in response to aging and oxidative stress.

Induction of Drosophila hsp70 protein was detected during aging in flight muscle and leg muscle in the absence of heat shock, using an hsp70-specific monoclonal antibody, and in transgenic flies containing hsp70-beta-galactosidase fusion protein reporter constructs. While hsp70 and reporter proteins were induced during aging, hsp70 message levels were not, indicating that aging-specific induction is primarily posttranscriptional. In contrast, hsp22 and hsp23 were found to be induced during aging at the RNA level and with a broader tissue distribution. The same muscle-specific hsp70 reporter expression pattern was observed in young flies mutant for catalase (H2O2:H2O2 oxidoreductase, EC 1.11.1.6). In catalase (cat) hypomorphic lines where flies survived to older ages, the time course of hsp70 reporter expression during aging was accelerated, and the initial and ultimate levels of expression were increased. The hsp70 reporter was also induced in young flies mutant for copper/zinc superoxide dismutase (superoxide:superoxide oxidoreductase, EC 1.15.1.1). Taken together, the results suggest that aging-specific hsp70 expression may be a result of oxidative damage.

Hematopoietic and lung abnormalities in mice with a null mutation of the common beta subunit of the receptors for granulocyte-macrophage colony-stimulating factor and interleukins 3 and 5.

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

A biomarker that identifies senescent human cells in culture and in aging skin in vivo.

Normal somatic cells invariably enter a state of irreversibly arrested growth and altered function after a finite number of divisions. This process, termed replicative senescence, is thought to be a tumor-suppressive mechanism and an underlying cause of aging. There is ample evidence that escape from senescence, or immortality, is important for malignant transformation. By contrast, the role of replicative senescence in organismic aging is controversial. Studies on cells cultured from donors of different ages, genetic backgrounds, or species suggest that senescence occurs in vivo and that organismic lifespan and cell replicative lifespan are under common genetic control. However, senescent cells cannot be distinguished from quiescent or terminally differentiated cells in tissues. Thus, evidence that senescent cells exist and accumulate with age in vivo is lacking. We show that several human cells express a beta-galactosidase, histochemically detectable at pH 6, upon senescence in culture. This marker was expressed by senescent, but not presenescent, fibroblasts and keratinocytes but was absent from quiescent fibroblasts and terminally differentiated keratinocytes. It was also absent from immortal cells but was induced by genetic manipulations that reversed immortality. In skin samples from human donors of different age, there was an age-dependent increase in this marker in dermal fibroblasts and epidermal keratinocytes. This marker provides in situ evidence that senescent cells may exist and accumulate with age in vivo.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E.

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H(+)-ATPase.

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7.

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.