Interaction of the protein import and folding machineries of the chloroplast.

We report the molecular cloning of import intermediate associated protein (IAP) 100, a 100-kDa protein of the chloroplast protein import machinery of peas. IAP100 contains two potential alpha-helical transmembrane segments and also behaves like an integral membrane protein. It was localized to the inner chloroplast envelope membrane. Immunoprecipitation experiments using monospecific anti-IAP100 antibodies and a nonionic detergent-generated chloroplast lysate gave the following results. (i) The four integral membrane proteins of the outer chloroplast import machinery were not coprecipitated with IAP100 indicating that the inner and outer membrane import machineries are not coupled in isolated chloroplasts. (ii) the major protein that coprecipitated with IAP100 was identified as stromal chaperonin 60 (cpn60); the association of IAP100 and cpn60 was specific and was abolished when immunoprecipitation was carried out in the presence of ATP. (iii) In a lysate from chloroplasts that had been preincubated for various lengths of time in an import reaction with radiolabeled precursor (pS) of the small subunit of Rubisco, we detected coimmunoprecipitation of IAP100, cpn60, and the imported mature form (S) of precursor. Relative to the time course of import, coprecipitation of S first increased and then decreased, consistent with a transient association of the newly imported S with the chaperonin bound to IAP100. These data suggest that IAP100 serves in recruiting chaperonin for folding of newly imported proteins.

The precursor of PsaD assembles into the photosystem I complex in two steps.

The present study addresses the assembly in the chloroplast thylakoid membranes of PsaD, a peripheral membrane protein of the photosystem I complex. Located on the stromal side of the thylakoids, PsaD was found to assemble in vitro into the membranes in its precursor (pre-PsaD) and also in its mature (PsaD) form. Newly assembled unprocessed pre-PsaD was resistant to NaBr and alkaline wash. Yet it was sensitive to proteolytic digestion. In contradistinction, when the assembled precursor was processed, the resulting mature PsaD was resistant to proteases to the same extent as endogenous [correction of endogeneous] PsaD. The accumulation of protease-resistant PsaD in the thylakoids correlated with the increase of mature-PsaD in the membranes. This protection of mature PsaD from proteolysis could not be observed when PsaD was in a soluble form-i.e. not assembled within the thylakoids. The data suggest that pre-PsaD assembles to the membranes and only in a second step processing takes place. The observation that the assembly of pre-PsaD is affected by salts to a much lesser extent than that of mature-PsaD supports a two-step assembly of pre-PsaD.

Self-renewal of primitive human hematopoietic cells (long-term-culture-initiating cells) in vitro and their expansion in defined medium.

A major goal of experimental and clinical hematology is the identification of mechanisms and conditions that support the expansion of transplantable hematopoietic stem cells. In normal marrow, such cells appear to be identical to (or represent a subset of) a population referred to as long-term-culture-initiating cells (LTC-ICs) so-named because of their ability to produce colony-forming cell (CFC) progeny for > or = 5 weeks when cocultured with stromal fibroblasts. Some expansion of LTC-ICs in vitro has recently been described, but identification of the factors required and whether LTC-IC self-renewal divisions are involved have remained unresolved issues. To address these issues, we examined the maintenance and/or generation of LTC-ICs from single CD34+ CD38- cells cultured for variable periods under different culture conditions. Analysis of the progeny obtained from cultures containing a feeder layer of murine fibroblasts engineered to produce steel factor, interleukin (IL)-3, and granulocyte colony-stimulating factor showed that approximately 20% of the input LTC-ICs (representing approximately 2% of the original CD34+ CD38- cells) executed self-renewal divisions within a 6-week period. Incubation of the same CD34+ CD38- starting populations as single cells in a defined (serum free) liquid medium supplemented with Flt-3 ligand, steel factor, IL-3, IL-6, granulocyte colony-stimulating factor, and nerve growth factor resulted in the proliferation of initial cells to produce clones of from 4 to 1000 cells within 10 days, approximately 40% of which included > or = 1 LTC-IC. In contrast, in similar cultures containing methylcellulose, input LTC-ICs appeared to persist but not divide. Overall the LTC-IC expansion in the liquid cultures was 30-fold in the first 10 days and 50-fold by the end of another 1-3 weeks. Documentation of human LTC-IC self-renewal in vitro and identification of defined conditions that permit their extensive and rapid amplification should facilitate analysis of the molecular mechanisms underlying these processes and their exploitation for a variety of therapeutic applications.

The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion.

Although the CD34 antigen is widely used in the identification and purification of hemopoietic stem and progenitor cells, its function within hemopoiesis is unknown. We have investigated this issue by ectopically expressing human (hu) CD34 on the surface of murine hemopoietic cells. Forced expression of hu-CD34 in the thymocytes of transgenic mice did not appear to affect the development, maturation, or distribution of murine T cells but did significantly increase their ability to adhere to bone marrow stromal layers of human but not mouse origin. Ectopic expression of hu-CD34 on murine 416B cells, a multipotential progenitor that expresses murine CD34, yielded similar results. In both cases hu-CD34-dependent adhesion was enhanced by molecular engagement of the hu-CD34 protein using anti-CD34 antibodies. These results provide evidence that CD34 promotes the adhesive interactions of hemopoietic cells with the stromal microenvironment of the bone marrow thereby implicating CD34 in regulation and compartmentalization of stem cells. We propose that CD34 regulates these processes in part via an indirect mechanism, signaling changes in cellular adhesion in response to molecular recognition of an as yet unidentified stromal CD34 counterreceptor or ligand.

A chloroplast processing enzyme involved in precursor maturation shares a zinc-binding motif with a recently recognized family of metalloendopeptidases.

Nuclear-encoded proteins targeted to the chloroplast are typically synthesized with N-terminal transit peptides which are proteolytically removed upon import. Structurally related proteins of 145 and 143 kDa copurify with a soluble chloroplast processing enzyme (CPE) that cleaves the precursor for the major light-harvesting chlorophyll a/b binding protein and have been implicated in the maturation of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase and acyl carrier protein. The 145- and 143-kDa proteins have not been found as a heterodimer and thus may represent functionally independent isoforms encoded by separate genes. Here we describe the primary structure of a 140-kDa polypeptide encoded by cDNAs isolated by using antibodies raised against the 145/143-kDa doublet. The 140-kDa polypeptide contains a transit peptide, and strikingly, a His-Xaa-Xaa-Glu-His zinc-binding motif that is conserved in a recently recognized family of metalloendopeptidases, which includes Escherichia coli protease III, insulin-degrading enzyme, and subunit beta of the mitochondrial processing peptidase. Identity of 25-30%, concentrated near the N terminus of the 140-kDa polypeptide, is found with these proteases. Expression of CPE in leaves is not light dependent. Indeed, transcripts are present in dark-grown plants, and the 145/143-kDa doublet and proteolytic activity are both found in etioplasts, as well as in root plastids. Thus, CPE appears to be a necessary component of the import machinery in photosynthetic and nonphotosynthetic tissues, and it may function as a general stromal processing peptidase in plastids.

Transforming growth factor beta mediates the progesterone suppression of an epithelial metalloproteinase by adjacent stroma in the human endometrium.

Unlike most normal adult tissues, cyclic growth and tissue remodeling occur within the uterine endometrium throughout the reproductive years. The matrix metalloproteinases (MMPs), a family of structurally related enzymes that degrade specific components of the extracellular matrix are thought to be the physiologically relevant mediators of extracellular matrix composition and turnover. Our laboratory has identified MMPs of the stromelysin family in the cycling human endometrium, implicating these enzymes in mediating the extensive remodeling that occurs in this tissue. While the stromelysins are expressed in vivo during proliferation-associated remodeling and menstruation-associated endometrial breakdown, none of the stromelysins are expressed during the progesterone-dominated secretory phase of the cycle. Our in vitro studies of isolated cell types have confirmed progesterone suppression of stromal MMPs, but a stromal-derived paracrine factor was found necessary for suppression of the epithelial-specific MMP matrilysin. In this report, we demonstrate that transforming growth factor beta (TGF-beta) is produced by endometrial stroma in response to progesterone and can suppress expression of epithelial matrilysin independent of progesterone. Additionally, we find that an antibody directed against the mammalian isoforms of TGF-beta abolishes progesterone suppression of matrilysin in stromal-epithelial cocultures, implicating TGF-beta as the principal mediator of matrilysin suppression in the human endometrium.

In vitro generation of hematopoietic stem cells from an embryonic stem cell line.

Hematopoietic stem cells (HSC) are unique in that they give rise both to new stem cells (self-renewal) and to all blood cell types. The cellular and molecular events responsible for the formation of HSC remain unknown mainly because no system exists to study it. Embryonic stem (ES) cells were induced to differentiate by coculture with the stromal cell line RP010 and the combination of interleukin (IL) 3, IL-6, and F (cell-free supernatants from cultures of the FLS4.1 fetal liver stromal cell line). Cell cytometry analysis of the mononuclear cells produced in the cultures was consistent with the presence of PgP-1+ Lin- early hematopoietic (B-220- Mac-1- JORO 75- TER 119-) cells and of fewer B-220+ IgM- B-cell progenitors and JORO 75+ T-lymphocyte progenitors. The cell-sorter-purified PgP-1+ Lin- cells produced by induced ES cells could repopulate the lymphoid, myeloid, and erythroid lineages of irradiated mice. The ES-derived PgP-1+ Lin- cells must possess extensive self-renewal potential, as they were able to produce hematopoietic repopulation of secondary mice recipients. Indeed, marrow cells from irradiated mice reconstituted (15-18 weeks before) with PgP-1+ Lin- cell-sorter-purified cells generated by induced ES cells repopulated the lymphoid, myeloid, and erythroid lineages of secondary mouse recipients assessed 16-20 weeks after their transfer into irradiated secondary mice. The results show that the culture conditions described here support differentiation of ES cells into hematopoietic cells with functional properties of HSC. It should now be possible to unravel the molecular events leading to the formation of HSC.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Cannabinoid ligand-receptor signaling in the mouse uterus.

Using RNA (Northern) blot hybridization and reverse transcription-PCR, we demonstrate that the brain-type cannabinoid receptor (CB1-R) mRNA, but not the spleen-type cannabinoid receptor (CB2-R) mRNA, is expressed in the mouse uterus and that this organ has the capacity to synthesize the putative endogenous cannabinoid ligand, anandamide (arachidonylethanolamide). The psychoactive cannabinoid component of marijuana--delta 9-tetrahydrocannabinol (THC)--or anandamide, but not the inactive and nonpsychoactive cannabidiol (CBD), inhibited forskolin-stimulated cyclic AMP formation in the mouse uterus, which was prevented by pertussis toxin pretreatment. These results suggest that uterine CB1-R is coupled to inhibitory guanine nucleotide-binding protein and is biologically active. Autoradiographic studies identified ligand binding sites ([3H]anandamide) in the uterine epithelium and stromal cells, suggesting that these cells are perhaps the targets for cannabinoid action. Scatchard analysis of the binding of [3H]WIN 55212-2, another cannabinoid receptor ligand, showed a single class of high-affinity binding sites in the endometrium with an apparent Kd of 2.4 nM and Bmax of 5.4 x 10(9) molecules per mg of protein. The gene encoding lactoferrin is an estrogen-responsive gene in the mouse uterus that was rapidly and transiently up-regulated by THC, but not by CBD, in ovariectomized mice in the absence of ovarian steroids. This effect, unlike that of 17 beta-estradiol (E2), was not influenced by a pure antiestrogen, ICI 182780, suggesting that the THC-induced uterine lactoferrin gene expression does not involve estrogen receptors. We propose that the uterus is a new target for cannabinoid ligand-receptor signaling.

Long-term in vivo expression of the human glucocerebrosidase gene in nonhuman primates after CD34+ hematopoietic cell transduction with cell-free retroviral vector preparations.

Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.