48 resultados para NCV, Cytokine, SCI,
Resumo:
The mechanisms responsible for cytokine-mediated antiviral effects are not fully understood. We approached this problem by studying the outcome of intraocular herpes simplex (HSV) infection in transgenic mice that express interferon gamma in the photoreceptor cells of the retina. These transgenic mice showed selective survival from lethal HSV-2 infection manifested in both eyes, the optic nerve, and the brain. Although transgenic mice developed greater inflammatory responses to the virus in the eyes, inflammation and viral titers in their brains were equivalent to nontransgenic mice. However, survival of transgenic mice correlated with markedly lower numbers of central neurons undergoing apoptosis. The protooncogene Bcl2 was found to be induced in the HSV-2-infected brains of transgenic mice, allowing us to speculate on its role in fostering neuronal survival in this model. These observations imply a complex interaction between cytokine, virus, and host cellular factors. Our results suggest a cytokine-regulated salvage pathway that allows for survival of infected neurons.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The influence of a synthetic retroviral peptide, CKS-17, on T helper type 1 (Th1)- or Th2-related cytokines was investigated in human blood mononuclear cells. Cells were stimulated with staphylococcal enterotoxin A, anti-CD3 plus anti-CD28 monoclonal antibodies, or lipopolysaccharide to induce cytokine mRNA. mRNA was detected by a reverse transcription-polymerase chain reaction or Northern blot analysis. CKS-17 down-regulated stimulant-induced mRNA accumulation for interferon gamma (IFN-gamma), interleukin (IL)-2, and p40 heavy and p35 light chains of IL-12, a cytokine that mediates development of Th1 response. CKS-17 up-regulated stimulant-induced mRNA accumulation of IL-10 and did not suppress Th2-related cytokine (IL-4, IL-5, IL-6, or IL-13) mRNA expression. A reverse sequence of CKS-17 peptide, used as a control, showed no such action. Anti-human IL-10 monoclonal antibody blocked ability of CKS-17 to inhibit mRNA accumulation for IFN-gamma but not the CKS-17 suppressive activity of IL-12 p40 heavy chain mRNA. Thus, CKS-17-mediated suppression of IFN-gamma mRNA expression is dependent upon augmentation of IL-10 production by CKS-17. This conserved component of several retroviral envelope proteins, CKS-17, may act as an immunomodulatory epitope responsible for cytokine dysregulation that leads to suppression of cellular immunity.