57 resultados para MOTILITY-STIMULATING PROTEIN


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cytotoxic lymphocytes are characterized by their inclusion of cytoplasmic granules that fuse with the plasma membrane following target cell recognition. We previously identified a cytotoxic granule membrane protein designated p15-TIA-1 that is immunochemically related to an RNA-recognition motif (RRM)-type RNA-binding protein designated p40-TIA-1. Although it was suggested that p15-TIA-1 might be derived from p40-T1A-1 by proteolysis, N-terminal amino acid sequencing of p15-TIA-1 immunoaffinity purified from a natural killer (NK) cell line by using monoclonal antibody (mAb) 2G9 revealed that p15-T1A-1 is identical to the deduced amino acid sequence of NKG7 and GIG-1, cDNAs isolated from NK cells and granulocyte-colony-stimulating factor-treated mononuclear cells, respectively. Epitope mapping revealed that mAb 2G9 recognizes the C terminus of p15-T1A-1 and p40-T1A-1. The deduced amino acid sequence of p15-T1A-1/NKG7/GIG-1 predicts that the protein possesses four transmembrane domains, and immuno-electron microscopy localizes the endogenous protein to the membranes of cytotoxic granules in NK cells. Given its subcellular localization, we propose to rename-this protein GMP-17, for granule membrane protein of 17 kDa. Immunofluorescence microscopy of freshly isolated NK cells confirms this granular localization. Target cell-induced NK cell degranulation results in translocation of GMP-17 from granules to the plasma membrane, suggesting a possible role for GMP-17 in regulating the effector function of lymphocytes and neutrophils.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transcription factor CREM (cAMP-responsive element modulator) plays a pivotal role in the nuclear response to cAMP in neuroendocrine cells. We have previously shown that follicle-stimulating hormone (FSH) directs CREM expression in male germ cells. The physiological importance of FSH in Sertoli cell function prompted us to analyze its effect on CREM expression in these cells. We observed a dramatic and specific increase in the CREM isoform ICER (inducible cAMP early repressor) expression, with a peak 4 h after FSH treatment of primary Sertoli cells. Interestingly, induced levels of ICER protein persist for a considerably longer time. Induction of the repressor ICER accompanies early down-regulation of the FSH receptor transcript, which leads to long-term desensitization. Here we show that ICER represses FSH receptor expression by binding to a CRE-like sequence in the regulatory region of the gene. Our results confirm the crucial role played by CREM in hormonal control and suggest its role in the long-term desensitization phenomenon of peptide membrane receptors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Philadelphia chromosome-positive leukemias result from the fusion of the BCR and ABL genes, which generates a functional chimeric molecule. The Abr protein is very similar to Bcr but lacks a structural domain which may influence its biological regulatory capabilities. Both Abr and Bcr have a GTPase-activating protein (GAP) domain similar to those found in other proteins that stimulate GTP hydrolysis by members of the Rho family of GTP-binding proteins, as well as a region of homology with the guanine nucleotide dissociation-stimulating domain of the DBL oncogene product. We purified as recombinant fusion proteins the GAP- and Dbl-homology domains of both Abr and Bcr. The Dbl-homology domains of Bcr and Abr were active in stimulating GTP binding to CDC42Hs, RhoA, Rac1, and Rac2 (rank order, CDC42Hs > RhoA > Rac1 = Rac2) but were inactive toward Rap1A and Ha-Ras. Both Bcr and Abr acted as GAPs for Rac1, Rac2, and CDC42Hs but were inactive toward RhoA, Rap1A, and Ha-Ras. Each individual domain bound in a noncompetitive manner to GTP-binding protein substrates. These data suggest the multifunctional Bcr and Abr proteins might interact simultaneously and/or sequentially with members of the Rho family to regulate and coordinate cellular signaling.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Thyroid gland function is regulated by the hypothalamic-pituitary axis via the secretion of TSH, according to environmental, developmental, and circadian stimuli. TSH modulates both the secretion of thyroid hormone and gland trophism through interaction with a specific guanine nucleotide-binding protein-coupled receptor (TSH receptor; TSH-R), which elicits the activation of the cAMP-dependent signaling pathway. After TSH stimulation, the levels of TSH-R RNA are known to decrease dramatically within a few hours. This phenomenon ultimately leads to homologous long-term desensitization of the TSH-R. Here we show that TSH drives the induction of the inducible cAMP early repressor (ICER) isoform of the cAMP response element (CRE) modulator gene both in rat thyroid gland and in the differentiated thyroid cell line FRTL-5. The kinetics of ICER protein induction mirrors the down-regulation of TSH-R mRNA. ICER binds to a CRE-like sequence in the TSH-R promoter and represses its expression. Thus, ICER induction by TSH in the thyroid gland represents a paradigm of the molecular mechanism by which pituitary hormones elicit homologous long-term desensitization.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

alpha-Melanocyte-stimulating hormone (alpha-MSH) is a potent inhibitory agent in all major forms of inflammation. To identify a potential mechanism of antiinflammatory action of alpha-MSH, we tested its effects on production of nitric oxide (NO), believed to be a mediator common to all forms of inflammation. We measured NO and alpha-MSH production in RAW 264.7 cultured murine macrophages stimulated with bacterial lipopolysaccharide and interferon gamma. alpha-MSH inhibited production of NO, as estimated from nitrite production and nitration of endogenous macrophage proteins. This occurred through inhibition of production of NO synthase II protein; steady-state NO synthase II mRNA abundance was also reduced. alpha-MSH increased cAMP accumulation in RAW cells, characteristic of alpha-MSH receptors in other cell types. RAW cells also expressed mRNA for the primary alpha-MSH receptor (melanocortin 1). mRNA for proopiomelanocortin, the precursor molecular of alpha-MSH, was expressed in RAW cells, and tumor necrosis factor alpha increased production and release of alpha-MSH. These results suggest that the proinflammatory cytokine tumor necrosis factor alpha can induce macrophages to increase production of alpha-MSH, which then becomes available to act upon melanocortin receptors on the same cells. Such stimulation of melanocortin receptors could modulate inflammation by inhibiting the production of NO. The results suggest that alpha-MSH is an autocrine factor in macrophages which modulates inflammation by counteracting the effects of proinflammatory cytokines.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chronic myelogenous leukemia evolves in two clinically distinct stages: a chronic and a blast crisis phase. The molecular changes associated with chronic phase to blast crisis transition are largely unknown. We have identified a cDNA clone, DR-nm23, differentially expressed in a blast-crisis cDNA library, which has approximately 70% sequence similarity to the putative metastatic suppressor genes, nm23-H1 and nm23-H2. The deduced amino acid sequence similarity to the proteins encoded by these two latter genes is approximately 65% and includes domains and amino acid residues (the leucine zipper-like and the RGD domain, a serine and a histidine residue in the NH2- and in the COOH-terminal portion of the protein, respectively) postulated to be important for nm23 function. DR-nm23 mRNA is preferentially expressed at early stages of myeloid differentiation of highly purified CD34+ cells. Its constitutive expression in the myeloid precursor 32Dc13 cell line, which is growth-factor dependent for both proliferation and differentiation, results in inhibition of granulocytic differentiation induced by granulocyte colony-stimulating factor and causes apoptotic cell death. These results are consistent with a role for DR-nm23 in normal hematopoiesis and raise the possibility that its overexpression contributes to differentiation arrest, a feature of blastic transformation in chronic myelogenous leukemia.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A number of factors both stimulating and inhibiting angiogenesis have been described. In the current work, we demonstrate that the angiogenic factor vascular endothelial growth factor (VEGF) activates mitogen-activated protein kinase (MAPK) as has been previously shown for basic fibroblast growth factor. The antiagiogenic factor 16-kDa N-terminal fragment of human prolactin inhibits activation of MAPK distal to autophosphorylation of the putative VEGF receptor, Flk-1, and phospholipase C-gamma. These data show that activation and inhibition of MAPK may play a central role in the control of angiogenesis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We used a bacterially expressed fusion protein containing the entire cytoplasmic domain of the human leukemia inhibitory factor (LIF) receptor to study its phosphorylation in response to LIF stimulation. The dose- and time-dependent relationships for phosphorylation of this construct in extracts of LIF-stimulated 3T3-L1 cells were superimposable with those for the stimulation of mitogen-activated protein kinase (MAPK). Indeed, phosphorylation of the cytoplasmic domain of the low-affinity LIF receptor alpha-subunit (LIFR) in Mono Q-fractionated, LIF-stimulated 3T3-L1 extracts occurred only in those fractions containing activated MAPK; Ser-1044 served as the major phosphorylation site in the human LIFR for MAPK both in agonist-stimulated 3T3-L1 lysates and by recombinant extracellular signal-regulated kinase 2 in vitro. Expression in rat H-35 hepatoma cells of LIFR or chimeric granulocyte-colony-stimulating factor receptor (G-CSFR)-LIFR mutants lacking Ser-1044 failed to affect cytokine-stimulated expression of a reporter gene under the control of the beta-fibrinogen gene promoter but eliminated the insulin-induced attenuation of cytokine-stimulated gene expression. Thus, our results identify the human LIFR as a substrate for MAPK and suggest a mechanism of heterologous receptor regulation of LIFR signaling occurring at Ser-1044.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Extracellular human immunodeficiency virus type 1 (HIV-1) Tat protein promotes growth of spindle cells derived from AIDS-associated Kaposi sarcoma (AIDS-KS), an angioproliferative disease very frequent in HIV-1-infected individuals. Normal vascular cells, progenitors of AIDS-KS cells, proliferate in response to Tat after exposure to inflammatory cytokines, whose levels are augmented in HIV-1-infected individuals and in KS lesions. Here we show that Tat also promotes AIDS-KS and normal vascular cells to migrate and to degrade the basement membrane and stimulates endothelial cell morphogenesis on a matrix substrate. These effects are obtained at picomolar concentrations of exogenous Tat and are promoted by the treatment of the cells with the same inflammatory cytokines stimulating expression of the receptors for Tat, the integrins alpha 5 beta 1 and alpha v beta 3. Thus, under specific circumstances, Tat has angiogenic properties. As Tat and its receptors are present in AIDS-KS lesions, these data may explain some of the mechanisms by which Tat can induce angiogenesis and cooperate in the development of AIDS-KS.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The E6 protein of the high-risk human papillomaviruses inactivates the tumor suppressor protein p53 by stimulating its ubiquitinylation and subsequent degradation. Ubiquitinylation is a multistep process involving a ubiquitin-activating enzyme, one of many distinct ubiquitin-conjugating enzymes, and in certain cases, a ubiquitin ligase. In human papillomavirus-infected cells, E6 and the E6-associated protein are thought to act as a ubiquitin-protein ligase in the ubiquitinylation of p53. Here we describe the cloning of a human ubiquitin-conjugating enzyme that specifically ubiquitinylates E6-associated protein. Furthermore, we define the biochemical pathway of p53 ubiquitinylation and demonstrate that in vivo inhibition of various components in the pathway leads to an inhibition of E6-stimulated p53 degradation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.