Phosphorylation of ubiquitin-activating enzyme in cultured cells.

Ubiquitin-activating enzyme, E1, is the first enzyme in the pathway leading to formation of ubiquitin-protein conjugates. E1 exists as two isoforms in human cells which are separable by electrophoresis. These isoforms migrate with apparent molecular sizes of 110 kDa and 117 kDa in SDS/polyacrylamide gels. Immunoprecipitation of E1 from lysates of HeLa cells metabolically labeled with [32P]phosphate indicated the presence of a phosphorylated form of E1 which migrates at 117 kDa. Phospho amino acid analysis identified serine as the phosphorylated residue in E1. Phosphorylated E1 was also detected in normal and transformed cells from another human cell line. Phosphatase-catalyzed dephosphorylation of E1 in vitro did not eliminate the 117-kDa E1 isoform detected by Coomassie staining after SDS/polyacrylamide gel electrophoresis, thereby demonstrating that phosphorylation is not the sole structural feature differentiating the isoforms of E1. These observations suggest new hypotheses concerning mechanisms of metabolic regulation of the ubiquitin conjugation pathway.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.