Overexpression of a Novel Arabidopsis Gene Related to Putative Zinc-Transporter Genes from Animals Can Lead to Enhanced Zinc Resistance and Accumulation

We describe the isolation of an Arabidopsis gene that is closely related to the animal ZnT genes (Zn transporter). The protein encoded by the ZAT (Zn transporter of Arabidopsis thaliana) gene has 398 amino acid residues and is predicted to have six membrane-spanning domains. To obtain evidence for the postulated function of the Arabidopsis gene, transgenic plants with the ZAT coding sequence under control of the cauliflower mosaic virus 35S promoter were analyzed. Plants obtained with ZAT in the sense orientation exhibited enhanced Zn resistance and strongly increased Zn content in the roots under high Zn exposure. Antisense mRNA-producing plants were viable, with a wild-type level of Zn resistance and content, like plants expressing a truncated coding sequence lacking the C-terminal cytoplasmic domain of the protein. The availability of ZAT can lead to a better understanding of the mechanism of Zn homeostasis and resistance in plants.

Transcriptional Down-Regulation by Abscisic Acid of Pathogenesis-Related β-1,3-Glucanase Genes in Tobacco Cell Cultures1

Class I isoforms of β-1,3-glucanases (βGLU I) and chitinases (CHN I) are antifungal, vacuolar proteins implicated in plant defense. Tobacco (Nicotiana tabacum L.) βGLU I and CHN I usually exhibit tightly coordinated developmental, hormonal, and pathogenesis-related regulation. Both enzymes are induced in cultured cells and tissues of cultivar Havana 425 tobacco by ethylene and are down-regulated by combinations of the growth hormones auxin and cytokinin. We report a novel pattern of βGLU I and CHN I regulation in cultivar Havana 425 tobacco pith-cell suspensions and cultured leaf explants. Abscisic acid (ABA) at a concentration of 10 μm markedly inhibited the induction of βGLU I but not of CHN I. RNA-blot hybridization and immunoblot analysis showed that only class I isoforms of βGLU and CHN are induced in cell culture and that ABA inhibits steady-state βGLU I mRNA accumulation. Comparable inhibition of β-glucuronidase expression by ABA was observed for cells transformed with a tobacco βGLU I gene promoter/β-glucuronidase reporter gene fusion. Taken together, the results strongly suggest that ABA down-regulates transcription of βGLU I genes. This raises the possibility that some of the ABA effects on plant-defense responses might involve βGLU I.

Enhancement of sensorimotor connections by conditioning-related stimulation in Aplysia depends upon postsynaptic Ca2+.

Classical conditioning of Aplysia's siphon-withdrawal reflex is thought to be due to a presynaptic mechanism-activity-dependent presynaptic facilitation of sensorimotor connections. Recent experiments with sensorimotor synapses in dissociated cell culture, however, provide an alternative cellular mechanism for classical conditioning-Hebbian long-term potentiation (LTP) of sensorimotor connections. Induction of Hebbian LTP of these connections is mediated by activation of N-methyl-D-aspartate-related receptors and requires the postsynaptic elevation of intracellular Ca2+. To determine whether the enhancement of sensorimotor synapses during classical conditioning in Aplysia-like LTP of sensorimotor synapses in culture-also depends upon the elevation of postsynaptic Ca2+, we carried out experiments involving the cellular analog of classical conditioning of siphon withdrawal. We examined changes in the strength of monosynaptic siphon sensorimotor connections in the abdominal ganglion of Aplysia following paired presentations of sensory neuron activation and tail nerve shock. This training regimen resulted in significant enhancement of the monosynaptic sensorimotor excitatory postsynaptic potential, as compared with the sensorimotor excitatory postsynaptic potential in preparations that received only test stimulation. Infusing the motor neuron with 1,2-bis(2-aminophenoxy)ethane-N,N-N',N'-tetraacetic acid, a specific chelator of intracellular Ca2+, prior to paired stimulation training blocked this synaptic enhancement. Our results implicate a postsynaptic, possibly Hebbian, mechanism in classical conditioning in Aplysia.

16S rRNA genes reveal stratified open ocean bacterioplankton populations related to the Green Non-Sulfur bacteria.

Microorganisms play an important role in the biogeochemistry of the ocean surface layer, but spatial and temporal structures in the distributions of specific bacterioplankton species are largely unexplored, with the exceptions of those organisms that can be detected by either autofluorescence or culture methods. The use of rRNA genes as genetic markers provides a tool by which patterns in the growth, distribution, and activity of abundant bacterioplankton species can be studied regardless of the ease with which they can be cultured. Here we report an unusual cluster of related 16S rRNA genes (SAR202, SAR263, SAR279, SAR287, SAR293, SAR307) cloned from seawater collected at 250 m in the Sargasso Sea in August 1991, when the water column was highly stratified and the deep chlorophyll maximum was located at a depth of 120 m. Phylogenetic analysis and an unusual 15-bp deletion confirmed that the genes were related to the Green Non-Sulfur phylum of the domain Bacteria. This is the first evidence that representatives of this phylum occur in the open ocean. Oligonucleotide probes were used to examine the distribution of the SAR202 gene cluster in vertical profiles (0-250 m) from the Atlantic and Pacific Oceans, and in discrete (monthly) time series (O and 200 m) (over 30 consecutive months in the Western Sargasso Sea. The data provide robust statistical support for the conclusion that the SAR202 gene cluster is proportionately most abundant at the lower boundary of the deep chlorophyll maximum (P = 2.33 x 10(-5)). These results suggest that previously unsuspected stratification of microbial populations may be a significant factor in the ecology of the ocean surface layer.

Developmentally related responses of maize catalase genes to salicylic acid.

The response of the maize catalase genes (Cat1, Cat2, and Cat3) to salicylic acid (SA) was examined at two distinct developmental stages: embryogenesis and germination. A unique, germination-related differential response of each maize catalase gene to various doses of SA was observed. During late embryogenesis, total catalase activity in scutella increased dramatically with 1 mM SA treatment. The accumulation of Cat2 transcript and CAT-2 isozyme protein provided the major contribution to the observed increase in total catalase activity. This increase was paralleled by the enhanced growth of germinated embryos at that stage. In a CAT-2 null mutant line, a full compensation of total catalase activity by the CAT-1 isozyme was observed in the presence of SA. This suggests that catalase is important for maintenance of normal cellular processes under stress conditions. SA at 1 mM, which enhances growth of precociously germinated embryos, appeared to inhibit seed germination at 1 day after inhibition. Furthermore, Cat2 transcript accumulation was inhibited at this stage. SA is probably not a direct signal for the induction of the catalase genes. Other signals, possibly germination-related regulator(s), might be responsible for the induction of the catalase genes. The effect of SA on the activity of purified catalase protein was also examined.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Specific association of the gene product of PKD2 with the TRPC1 channel

The function(s) of the genes (PKD1 and PKD2) responsible for the majority of cases of autosomal dominant polycystic kidney disease is unknown. While PKD1 encodes a large integral membrane protein containing several structural motifs found in known proteins involved in cell–cell or cell–matrix interactions, PKD2 has homology to PKD1 and the major subunit of the voltage-activated Ca2+ channels. We now describe sequence homology between PKD2 and various members of the mammalian transient receptor potential channel (TRPC) proteins, thought to be activated by G protein-coupled receptor activation and/or depletion of internal Ca2+ stores. We show that PKD2 can directly associate with TRPC1 but not TRPC3 in transfected cells and in vitro. This association is mediated by two distinct domains in PKD2. One domain involves a minimal region of 73 amino acids in the C-terminal cytoplasmic tail of PKD2 shown previously to constitute an interacting domain with PKD1. However, distinct residues within this region mediate specific interactions with TRPC1 or PKD1. The C-terminal domain is sufficient but not necessary for the PKD2–TRPC1 association. A more N-terminal domain located within transmembrane segments S2 and S5, including a putative pore helical region between S5 and S6, is also responsible for the association. Given the ability of the TRPC to form functional homo- and heteromultimeric complexes, these data provide evidence that PKD2 may be functionally related to TRPC proteins and suggest a possible role of PKD2 in modulating Ca2+ entry in response to G protein-coupled receptor activation and/or store depletion.

Unique regulatory properties of the type 2a Ca2+ channel β subunit caused by palmitoylation

β subunits of voltage-gated Ca2+ channels are encoded in four genes and display additional molecular diversity because of alternative splicing. At the functional level, all forms are very similar except for β2a, which differs in that it does not support prepulse facilitation of α1C Ca2+ channels, inhibits voltage-induced inactivation of neuronal α1E Ca2+ channels, and is more effective in blocking inhibition of α1E channels by G protein-coupled receptors. We show that the distinguishing properties of β2a, rather than interaction with a distinct site of α1, are because of the recently described palmitoylation of cysteines in positions three and four, which also occurs in the Xenopus oocyte. Essentially, all of the distinguishing features of β2a were lost in a mutant that could not be palmitoylated [β2a(Cys3,4Ser)]. Because protein palmitoylation is a dynamic process, these findings point to the possibility that regulation of palmitoylation may contribute to activity-dependent neuronal and synaptic plasticity. Evidence is presented that there may exist as many as three β2 splice variants differing only in their N-termini.

A family of fibrinogen-related proteins that precipitates parasite-derived molecules is produced by an invertebrate after infection

After infection with the digenetic trematode Echinostoma paraensei, hemolymph of the snail Biomphalaria glabrata contains lectins comprised of 65-kDa subunits that precipitate polypeptides secreted by E. paraensei intramolluscan larvae. Comparable activity is lacking in hemolymph of uninfected snails. Three different cDNAs with sequence similarities to peptides derived from the 65-kDa lectins were obtained and unexpectedly found to encode fibrinogen-related proteins (FREPs). These FREPs also contained regions with sequence similarity to Ig superfamily members. B. glabrata has at least five FREP genes, three of which are expressed at increased levels after infection. Elucidation of components of the defense system of B. glabrata is relevant because this snail is an intermediate host for Schistosoma mansoni, the most widely distributed causative agent of human schistosomiasis. These results are novel in suggesting a role for invertebrate FREPs in recognition of parasite-derived molecules and also provide a model for investigating the diversity of molecules functioning in nonself-recognition in an invertebrate.

A screen for fast evolving genes from Drosophila

In an attempt to quantify the rates of protein sequence divergence in Drosophila, we have devised a screen to differentiate between slow and fast evolving genes. We find that over one-third of randomly drawn cDNAs from a Drosophila melanogaster library do not cross-hybridize with Drosophila virilis DNA, indicating that they evolve with a very high rate. To determine the evolutionary characteristics of such protein sequences, we sequenced their homologs from a more closely related species (Drosophila yakuba). The amino acid substitution rates among these cDNAs are among the fastest known and several are only about 2-fold lower than the corresponding values for silent substitutions. An analysis of within-species polymorphisms for one of these sequences reveals an exceptionally high number of polymorphic amino acid positions, indicating that the protein is not under strong negative selection. We conclude that the Drosophila genome harbors a substantial proportion of genes with a very high divergence rate.

The mouse histone H2a gene contains a small element that facilitates cytoplasmic accumulation of intronless gene transcripts and of unspliced HIV-1-related mRNAs

Histone mRNAs are naturally intronless and accumulate efficiently in the cytoplasm. To learn whether there are cis-acting sequences within histone genes that allow efficient cytoplasmic accumulation of RNAs, we made recombinant constructs in which sequences from the mouse H2a gene were cloned into a human β-globin cDNA. By using transient transfection and RNase protection analysis, we demonstrate here that a 100-bp sequence within the H2a coding region permits efficient cytoplasmic accumulation of the globin cDNA transcripts. We also show that this sequence appears to suppress splicing and can functionally replace Rev and the Rev-responsive element in the cytoplasmic accumulation of unspliced HIV-1-related mRNAs. Like the Rev-responsive element, this sequence acts in an orientation-dependent manner. We thus propose that the sequence identified here may be a member of the cis-acting elements that facilitate the cytoplasmic accumulation of naturally intronless gene transcripts.

Activation of a caspase 3-related cysteine protease is required for glutamate-mediated apoptosis of cultured cerebellar granule neurons

Neurotoxicity induced by overstimulation of N-methyl-d-aspartate (NMDA) receptors is due, in part, to a sustained rise in intracellular Ca2+; however, little is known about the ensuing intracellular events that ultimately result in cell death. Here we show that overstimulation of NMDA receptors by relatively low concentrations of glutamate induces apoptosis of cultured cerebellar granule neurons (CGNs) and that CGNs do not require new RNA or protein synthesis. Glutamate-induced apoptosis of CGNs is, however, associated with a concentration- and time-dependent activation of the interleukin 1β-converting enzyme (ICE)/CED-3-related protease, CPP32/Yama/apopain (now designated caspase 3). Further, the time course of caspase 3 activation after glutamate exposure of CGNs parallels the development of apoptosis. Moreover, glutamate-induced apoptosis of CGNs is almost completely blocked by the selective cell permeable tetrapeptide inhibitor of caspase 3, Ac-DEVD-CHO but not by the ICE (caspase 1) inhibitor, Ac-YVAD-CHO. Western blots of cytosolic extracts from glutamate-exposed CGNs reveal both cleavage of the caspase 3 substrate, poly(ADP-ribose) polymerase, as well as proteolytic processing of pro-caspase 3 to active subunits. Our data demonstrate that glutamate-induced apoptosis of CGNs is mediated by a posttranslational activation of the ICE/CED-3-related cysteine protease caspase 3.

Increase of intracellular Ca2+ and relocation of E-cadherin during experimental decompaction of mouse embryos

To determine the role of intracellular Ca2+ in compaction, the first morphogenetic event in embryogenesis, we analyzed preimplantation mouse embryos under several decompacting conditions, including depletion of extracellular Ca2+, blocking of Ca2+ channels, and inhibition of microfilaments, calmodulin, and intracellular Ca2+ release. Those treatments induced decompaction of mouse morulae and simultaneously induced changes in cytosolic free Ca2+ concentration and deregionalization of E-cadherin and fodrin. When morulae were allowed to recompact, the location of both proteins recovered. In contrast, actin did not change its cortical location with compaction nor with decompaction-recompaction. Calmodulin localized in areas opposite to cell–cell contacts in eight-cell stage embryos before and after compaction. Inhibition of calmodulin with trifluoperazine induced its delocalization while morulae decompacted. A nonspecific rise of intracellular free Ca2+ provoked by ionomycin did not affect the compacted shape. Moreover, the same decompacting treatments when applied to uncompacted embryos did not produce any change in intracellular Ca2+. Our results demonstrate that in preimplantation mouse embryos experimentally induced stage-specific changes of cell shape are accompanied by changes of intracellular free Ca2+ and redistribution of the cytoskeleton-related proteins E-cadherin, fodrin, and calmodulin. We conclude that intracellular Ca2+ specifically is involved in compaction and probably regulates the function and localization of cytoskeleton elements.

Two hemoglobin genes in Arabidopsis thaliana: The evolutionary origins of leghemoglobins

We cloned two hemoglobin genes from Arabidopsis thaliana. One gene, AHB1, is related in sequence to the family of nonsymbiotic hemoglobin genes previously identified in a number of plant species (class 1). The second hemoglobin gene, AHB2, represents a class of nonsymbiotic hemoglobin (class 2) related in sequence to the symbiotic hemoglobin genes of legumes and Casuarina. The properties of these two hemoglobins suggest that the two families of nonsymbiotic hemoglobins may differ in function from each other and from the symbiotic hemoglobins. AHB1 is induced, in both roots and rosette leaves, by low oxygen levels. Recombinant AHB1 has an oxygen affinity so high as to make it unlikely to function as an oxygen transporter. AHB2 is expressed at a low level in rosette leaves and is low temperature-inducible. AHB2 protein has a lower affinity for oxygen than AHB1 but is similar to AHB1 in having an unusually low, pH-sensitive oxygen off-rate.

INAF, a protein required for transient receptor potential Ca2+ channel function

The trp gene of Drosophila encodes a subunit of a class of Ca2+-selective light-activated channels that carry the bulk of the phototransduction current. Transient receptor potential (TRP) homologs have been identified throughout animal phylogeny. In vertebrates, TRP-related channels have been suggested to mediate “store-operated Ca2+ entry,” which is important in Ca2+ homeostasis in a wide variety of cell types. However, the mechanisms of activation and regulation of the TRP channel are not known. Here, we report on the Drosophila inaF gene, which encodes a highly eye-enriched protein, INAF, that appears to be required for TRP channel function. A null mutation in this gene significantly reduces the amount of the TRP protein and, in addition, specifically affects the TRP channel function so as to nearly shut down its activity. The inaF mutation also dramatically suppresses the severe degeneration caused by a constitutively active mutation in the trp gene. Although the reduction in the amount of the TRP protein may contribute to these phenotypes, several lines of evidence support the view that inaF mutations also more directly affect the TRP channel function, suggesting that the INAF protein may have a regulatory role in the channel function.