Role of the arginine-nitric oxide pathway in the regulation of vascular smooth muscle cell proliferation

The objective of this study was to elucidate the mechanisms by which nitric oxide (NO) inhibits rat aortic smooth muscle cell (RASMC) proliferation. Two products of the arginine-NO pathway interfere with cell growth by distinct mechanisms. NG-hydroxyarginine and NO appear to interfere with cell proliferation by inhibiting arginase and ornithine decarboxylase (ODC), respectively. S-nitroso-N-acetylpenicillamine, (Z)-1-[N-(2-aminoethyl)-N-(2-aminoethyl)-amino]-diazen-1-ium-1,2-diolate, and a nitroaspirin derivative (NCX 4016), each of which is a NO donor agent, inhibited RASMC growth at concentrations of 1–3 μM by cGMP-independent mechanisms. The cytostatic action of the NO donor agents as well as α-difluoromethylornithine (DFMO), a known ODC inhibitor, was prevented by addition of putrescine but not ornithine. These observations suggested that NO, like DFMO, may directly inhibit ODC. Experiments with purified, recombinant mammalian ODC revealed that NO inhibits ODC possibly by S-nitrosylation of the active site cysteine in ODC. DFMO, as well as the NO donor agents, interfered with cellular polyamine (putrescine, spermidine, spermine) production. Conversely, increasing the expression and catalytic activity of arginase I in RASMC either by transfection of cells with the arginase I gene or by induction of arginase I mRNA with IL-4 resulted in increased urea and polyamine production as well as cell proliferation. Finally, coculture of rat aortic endothelial cells, which had been pretreated with lipopolysaccharide plus a cytokine mixture to induce NO synthase and promote NO production, caused NO-dependent inhibition of target RASMC proliferation. This study confirms the inhibitory role of the arginine-NO pathway in vascular smooth muscle proliferation and indicates that one mechanism of action of NO is cGMP-independent and attributed to its capacity to inhibit ODC.

Use of a New Tetrazolium-Based Assay to Study the Production of Superoxide Radicals by Tobacco Cell Cultures Challenged with Avirulent Zoospores of Phytophthora parasitica var nicotianae1

The relationship between the production of reactive oxygen species and the hypersensitive response (HR) of tobacco (Nicotiana tabacum L.) toward an incompatible race of the Oomycete Phytophthora parasitica var nicotianae has been investigated. A new assay for superoxide radical (O2−) production based on reduction of the tetrazolium dye sodium,3′-(1-[phenylamino-carbonyl]-3,4-tetrazolium)-bis(4-methoxy-6-nitro) benzene-sulfonic acid hydrate (XTT) has enabled the quantitative estimation of perhydroxyl/superoxide radical acid-base pair (HO2·/O2−) production during the resistant response. Tobacco suspension cells were inoculated with zoospores from compatible or incompatible races of the pathogen. Subsequent HO2·/O2− production was monitored by following the formation of XTT formazan. In the incompatible interaction only, HO2·/O2− was produced in a minor burst between 0 and 2 h and then in a major burst between 8 and 10 h postinoculation. During this second burst, rates of XTT reduction equivalent to a radical flux of 9.9 × 10−15 mol min−1 cell−1 were observed. The HO2·/O2− scavengers O2− dismutase and Mn(III)desferal each inhibited dye reduction. An HR was observed in challenged, resistant cells immediately following the second burst of radical production. Both scavengers inhibited the HR when added prior to the occurrence of either radical burst, indicating that O2− production is a necessary precursor to the HR.

A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes.

We have generated a human 293-derived retroviral packaging cell line (293GPG) capable of producing high titers of recombinant Moloney murine leukemia virus particles that have incorporated the vesicular stomatitis virus G (VSV-G) protein. To achieve expression of the retroviral gag-pol polyprotein, the precise coding sequences for gag-pol were introduced into a vector which utilizes totally nonretroviral signals for gene expression. Because constitutive expression of the VSV-G protein is toxic in 293 cells, we used the tetR/VP 16 transactivator and teto minimal promoter system for inducible, tetracycline-regulatable expression of VSV-G. After stable transfection of the 293GPG packaging cell line with the MFG.SnlsLacZ retroviral vector construct, it was possible to readily isolate stable virus-producing cell lines with titers approaching 10(7) colony-forming units/ml. Transient transfection of 293GPG cells using a modified version of MFG.SnlsLacZ, in which the cytomegalovirus IE promoter was used to drive transcription of the proviral genome, led to titers of approximately 10(6) colony-forming units/ml. The retroviral/VSV-G pseudotypes generated using 293GPG cells were significantly more resistant to human complement than commonly used amphotropic vectors and could be highly concentrated (> 1000-fold). This new packaging cell line may prove to be particularly useful for assessing the potential use of retroviral vectors for direct in vivo gene transfer. The design of the cell line also provides at least theoretical advantages over existing cell lines with regard to the possible release of replication-competent virus.

Nitric oxide production in SJL mice bearing the RcsX lymphoma: a model for in vivo toxicological evaluation of NO.

SJL mice spontaneously develop pre-B-cell lymphoma that we hypothesized might stimulate macrophages to produce nitric oxide (NO.). Transplantation of an aggressive lymphoma (RcsX) was used to induce tumor formation. Urinary nitrate excretion was measured as an index of NO. production and was found to increase 50-fold by 13 days after tumor injection. NO. production was prevented by the addition of a nitric oxide synthase (NOS) inhibitor. The expression of inducible NOS (iNOS) in various tissues was estimated by Western blot analysis and localized by immunohistochemistry. The synthase was detected in the spleen, lymph nodes, and liver of treated but not control mice. To assess whether the iNOS-staining cells were macrophages, spleen sections from ResX-bearing animals were costained with anti-iNOS antibody and the anti-macrophage antibody moma-2. Expression of iNOS was found to be limited to a subset of the macrophage population. The concentration of gamma-interferon, a cytokine known to induce NO. production by macrophages, in the serum of tumor-bearing mice, was measured and found to be elevated 25-fold above untreated mice. The ability of ResX-activated macrophages to inhibit splenocyte growth in primary culture was estimated and macrophage-derived NO. was found to inhibit cell division 10-fold. Our findings demonstrate that ResX cells stimulate NO. production by macrophages in the spleen and lymph nodes of SJL mice, and we believe this experimental model will prove useful for study of the toxicological effects of NO. under physiological conditions.

Subcutaneous vaccination with irradiated, cytokine-producing tumor cells stimulates CD8+ cell-mediated immunity against tumors located in the "immunologically privileged" central nervous system.

Vaccination with cytokine-producing tumor cells generates potent immune responses against tumors outside the central nervous system (CNS). The CNS, however, is a barrier to allograft and xenograft rejection, and established tumors within the CNS have failed to respond to other forms of systemic immunotherapy. To determine what barriers the "immunologically privileged" CNS would pose to cytokine-assisted tumor vaccines and what cytokines would be most efficacious against tumors within the CNS, we irradiated B16 murine melanoma cells producing murine interleukin 2 (IL-2), IL-3, IL-4, IL-6, gamma-interferon, or granulocyte-macrophage colony stimulating factor (GM-CSF) and used these cells as subcutaneous vaccines against tumors within the brain. Under conditions where untransfected B16 cells had no effect, cells producing IL-3, IL-6, or GM-CSF increased the survival of mice challenged with viable B16 cells in the brain. Vaccination with B16 cells producing IL-4 or gamma-interferon had no effect, and vaccination with B16 cells producing IL-2 decreased survival time. GM-CSF-producing vaccines were also able to increase survival in mice with pre-established tumors. The response elicited by GM-CSF-producing vaccines was found to be specific to tumor type and to be abrogated by depletion of CD8+ cells. Unlike the immunity generated against subcutaneous tumors by GM-CSF, however, the effector responses generated against tumors in the CNS were not dependent on CD4+ cells. These data suggest that cytokine-producing tumor cells are very potent stimulators of immunity against tumors within the CNS, but effector responses in the CNS may be different from those obtained against subcutaneous tumors.

Interleukin 2 production, not the pattern of early T-cell antigen receptor-dependent tyrosine phosphorylation, controls anergy induction by both agonists and partial agonists.

Full activation of T cells requires signaling through the T-cell antigen receptor (TCR) and additional surface molecules interacting with ligands on the antigen-presenting cell. TCR recognition of agonist ligands in the absence of accessory signals frequently results in the induction of a state of unresponsiveness termed anergy. However, even in the presence of costimulation, anergy can be induced by TCR partial agonists. The unique pattern of early receptor-induced tyrosine phosphorylation events induced by partial agonists has led to the hypothesis that altered TCR signaling is directly responsible for the development of anergy. Here we show that anergy induction is neither correlated with nor irreversibly determined by the pattern of early TCR-induced phosphorylation. Rather, it appears to result from the absence of downstream events related to interleukin 2 receptor occupancy and/or cell division. This implies that the anergic state can be manipulated independently of the precise pattern of early biochemical changes following TCR occupancy, a finding with implications for understanding the induction of self-tolerance and the use of partial agonist ligands in the treatment of autoimmune diseases.

Local production of the p40 subunit of interleukin 12 suppresses T-helper 1-mediated immune responses and prevents allogeneic myoblast rejection.

The p40 subunit of interleukin 12 (IL-12p40) has been known to act as an IL-12 antagonist in vitro. We here describe the immunosuppressive effect of IL-12p40 in vivo. A murine myoblast cell line, C2C12, was transduced with retro-virus vectors carrying the lacZ gene as a marker and the IL-12p40 gene. IL-12p40 secreted from the transfectant inhibited the IL-12-induced interferon gamma (IFN-gamma) production by splenocytes in vitro. Survival of C2C12 transplanted into allogeneic recipients was substantially prolonged when transduced with IL-12p40. Cytokine (IL-2 and IFN-gamma) production and cytotoxic T lymphocyte induction against allogeneic C2C12 were impaired in the recipients transplanted with the IL-12p40 transfectant. Delayed-type hypersensitivity response against C2C12 was also diminished in the IL-12p40 recipients. Furthermore, serum antibodies against beta-galactosidase of the T-helper 1-dependent isotypes (IgG2 and IgG3) were decreased in the IL-12p40 recipients. These results indicate that locally produced IL-12p40 exerts a potent immunosuppressive effect on T-helper 1-mediated immune responses that lead to allograft rejection. Therefore, IL-12p40 gene transduction would be useful for preventing the rejection of allografts and genetically modified own cells that are transduced with potentially antigenic molecules in gene therapy.

Genetic engineering of carbohydrate biosynthetic pathways in transgenic mice demonstrates cell cycle-associated regulation of glycoconjugate production in small intestinal epithelial cells.

Proliferation, migration-associated differentiation, and cell death occur continuously and in a spatially well-organized fashion along the crypt-villus axis of the mouse small intestine, making it an attractive system for studying how these processes are regulated and interrelated. A pathway for producing glycoconjugates was engineered in adult FVB/N transgenic mice by expressing a human alpha 1,3/4-fucosyltransferase (alpha 1,3/4-FT; EC 2.4.1.65) along the length of this crypt-villus axis. The alpha 1,3/4-FT can use lacto-N-tetraose or lacto-neo-N-tetraose core chains to generate Lewis (Le) blood group antigens Le(a) or Le(x), respectively, and H type 1 or H type 2 core chains to produce Leb and Le(y). Single- and multilabel immunohistochemical studies revealed that expression of the alpha 1,3/4-FT results in production of Le(a) and Leb antigens in both undifferentiated proliferated crypt cells and in differentiated postmitotic villus-associated epithelial cells. In contrast, Le(x) antigens were restricted to crypt cells. Villus enterocytes can be induced to reenter the cell cycle by expression of simian virus 40 tumor antigen under the control of a promoter that only functions in differentiated members of this lineage. Bitransgenic animals, generated from a cross of FVB/N alpha 1,3/4-FT with FVB/N simian virus 40 tumor antigen mice, expand the range of Le(x) expression to include villus-associated enterocytes that have reentered the cell cycle. Thus, the fucosylations unveil a proliferation-dependent switch in oligosaccharide production, as defined by a monoclonal antibody specific for the Le(x) epitope. These findings show that genetic engineering of oligosaccharide biosynthetic pathways can be used to define markers for entry into, or progression through, the cell cycle and to identify changes in endogenous carbohydrate metabolism that occur when proliferative status is altered in a manner that is not deleterious to the system under study.

Immunoregulatory properties of ISG15, an interferon-induced cytokine.

ISG15 is a 15-kDa protein of unique primary amino acid sequence, which is transcriptionally regulated by interferon (IFN) alpha and IFN-beta. Because it is synthesized in many cell types and secreted from human monocytes and lymphocytes, we postulated that ISG15 might act to modulate immune cell function. ISG15 stimulated B-depleted lymphocyte proliferation in a dose-dependent manner with significant proliferation induced by amounts of ISG15 as low as 1 ng/ml (58 pM). Maximal stimulation of [3H]thymidine incorporation by B-depleted lymphocytes occurred at 6-7 days. Immunophenotyping of ISG15-treated B-depleted lymphocyte cultures indicated a 26-fold expansion of natural killer (NK) cells (CD56+). In cytotoxicity assays, ISG15 was a potent inducer of cytolytic activity directed against both K562 (100 lytic units per 10(6) cells) and Daudi (80 lytic units per 10(6) cells) tumor cell targets, indicating that ISG15 enhanced lymphokine-activated killer-like activity. ISG15-induced NK cell proliferation required coculturing of T and NK cells, suggesting that soluble factor(s) were required. Measurement of ISG15-treated cell culture supernatants for cytokines indicated production of IFN-gamma (> 700 units/ml). No interleukin 2 or interleukin 12 was detected. IFN-gamma itself failed to stimulate lymphocyte proliferation and lymphokine-activated killer cell activation. Further, induced expression of IFN-gamma mRNA was detected by reverse transcription-PCR in T lymphocytes after ISG15 treatment but not in NK cells. Enhancement of NK cell proliferation, augmentation of non-major histocompatibility complex-restricted cytotoxicity, and induction of IFN-gamma from T cells identify ISG15 as a member of the cytokine cascade and suggest that it may be responsible for amplifying and directing some of the immunomodulatory effects of IFN-alpha or IFN-beta.

Interleukin 2 induces CD8+ T cell-mediated suppression of human immunodeficiency virus replication in CD4+ T cells and this effect overrides its ability to stimulate virus expression.

The nonlytic suppression of human immunodeficiency virus (HIV) production from infected CD4+ T cells by CD8+ lymphocytes from HIV-infected individuals is one of the most potent host-mediated antiviral activities observed in vitro. We demonstrate that the pleiotropic cytokine interleukin 2 (IL-2), but not IL-12, is a potent inducer of the CD8+ HIV suppressor phenomenon. IL-2 induces HIV expression in peripheral blood or lymph node mononuclear cells from HIV-infected individuals in the absence of CD8+ T cells. However, IL-2 induces CD8+ T cells to suppress HIV expression when added back to these cultures, and this effect dramatically supersedes the ability to IL-2 to induce HIV expression. Five to 25 times fewer CD8+ cells were required to obtain comparable levels of inhibition of viral production if they were activated in the presence of IL-2 as compared with IL-12 or no exogenous cytokine. Furthermore, IL-2 appeared either to induce a qualitative increase in HIV suppressor cell activity or to increase the relative frequency of suppressor cells in the activated (CD25+) CD8+ populations. Analyses of proviral levels in peripheral blood mononuclear cells suggest that CD8+ T cell-mediated lysis of in vivo infected cells is not induced by IL-2. These results have implications for our understanding of the effects of impaired IL-2 production during HIV disease as well as the overall effects of IL-2-based immunotherapy on HIV replication in vivo.

Single cell analysis of cytokine gene coexpression during CD4+ T-cell phenotype development.

CD4+ T cells from alpha beta-T-cell receptor transgenic mice were analyzed for coexpression of cytokine mRNAs during phenotype development using a double-label in situ hybridization technique. T cells that produced cytokines in the primary response were a fraction of the activated population, and only a minority of the cytokine-positive cells coexpressed two cytokines. In secondary responses, frequencies of double-positive cells increased, although they remained a minority of the total. Of the cytokine pairs examined, interleukin (IL)-4 and IL-5 were the most frequently coexpressed. IL-4 and interferon gamma showed the greatest tendency toward segregation of expression, being rarely coexpressed after the primary stimulation. These data indicate that there is significant heterogeneity of cytokine gene expression by individual CD4+ T cells during early antigenic responses. Coexpression of any pairs of cytokines, much less Th1 and Th2 cytokines, is generally the exception. The Th0 phenotype is a population phenotype rather than an individual cell phenotype.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

IgE receptor-positive non-B/non-T cells dominate the production of interleukin 4 and interleukin 6 in immunized mice.

The phenotype and antigenic specificity of cells secreting interleukin (IL) 4, IL-6, and interferon gamma was studied in mice during primary and secondary immune responses. T lymphocytes were the major source of interferon gamma, whereas non-B/non-T cells were the dominant source of IL-4 and IL-6 in the spleens of immunized animals. Cytokine-secreting non-B/non-T cells expressed surface receptors for IgE and/or IgG types II/III. Exposing these cells to antigen-specific IgE or IgG in vivo (or in vitro) "armed" them to release IL-4 and IL-6 upon subsequent antigenic challenge. These findings suggest that non-B/non-T cells may represent the "natural immunity" analogue of CD4+ T helper type 2 cells and participate in a positive feedback loop involved in the perpetuation of T helper type 2 cell responses.