The 94- to 97-kDa mouse macrophage membrane protein that recognizes oxidized low density lipoprotein and phosphatidylserine-rich liposomes is identical to macrosialin, the mouse homologue of human CD68.

We have previously reported the partial purification of a 94- to 97-kDa plasma membrane protein from mouse peritoneal macrophages that binds oxidatively modified low density lipoprotein (OxLDL) and phosphatidylserine-rich liposomes. We have now identified that protein as macrosialin, a previously cloned macrophage-restricted membrane protein in the lysosomal-associated membrane protein family (mouse homologue of human CD68). Early in the course of purification of the 94- to 97-kDa protein, a new OxLDL-binding band at 190-200 kDa appeared and copurified with the 94- to 97-kDa protein. The HPLC pattern of tryptic peptides from this higher molecular mass ligand-binding band closely matched that derived from the 94- to 97-kDa band. Specifically, the same three macrosialin-derived tryptic peptides (9, 9, and 15 residues) were present in the purified 94- to 97-kDa band and in the 190- to 200-kDa band and antisera raised against peptide sequences in macrosialin recognized both bands. An antiserum against macrosialin precipitated most of the 94- to 97-kDa OxLDL-binding material. We conclude that the binding of OxLDL to mouse macrophage membranes is in part attributable to macrosialin. Our previous studies show that OxLDL competes with oxidized red blood cells and with apoptotic thymocytes for binding to mouse peritoneal macrophages. Whether macrosialin plays a role in recognition of OxLDL and oxidatively damaged cells by intact macrophages remains uncertain.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E.

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Increased expression and activity of sodium channels in alveolar type II cells of hyperoxic rats.

We investigated the cellular and molecular events associated with the increase in sodium transport across the alveolar epithelium of rats exposed to hyperoxia (85% O2 for 7 days followed by 100% O2 for 4 days). Alveolar type II (ATII) cell RNA was isolated and probed with a cDNA for one of the rat colonic epithelial sodium channel subunits (alpha rENaC). The alpha rENaC mRNA (3.7-kb transcript) increased 3-fold in ATII cell RNA isolated from rats exposed to 85% O2 for 7 days and 6-fold after 4 days of subsequent exposure to 100% O2. In situ hybridization revealed increased expression of alpha rENaC mRNA transcripts in both airway and alveolar epithelial cells of hyperoxic rats. When immunostained with a polyclonal antibody to kidney sodium channel protein, ATII cells from hyperoxic rats exhibited a significant increase in the amount of immunogenic protein present in both the plasma membrane and the cytoplasm. When patched in the whole-cell mode, ATII cells from hyperoxic rats exhibited amiloride and 5-(N-ethyl-N-isopropyl)-2',4'-amiloride (EIPA)-sensitive currents that were 100% higher compared with those obtained from air-breathing rats. Single-channel sodium currents (mean conductance of 25 pS) were seen in ATII cells patched in both the inside-out and cell-attached modes. The number and open probability of these channels increased significantly during exposure to hyperoxia. Exposure to sublethal hyperoxia up-regulated both alpha rENaC mRNA and the functional expression of sodium channels in ATII cells.

Evidence of autocrine modulation of macrophage nitric oxide synthase by alpha-melanocyte-stimulating hormone.

alpha-Melanocyte-stimulating hormone (alpha-MSH) is a potent inhibitory agent in all major forms of inflammation. To identify a potential mechanism of antiinflammatory action of alpha-MSH, we tested its effects on production of nitric oxide (NO), believed to be a mediator common to all forms of inflammation. We measured NO and alpha-MSH production in RAW 264.7 cultured murine macrophages stimulated with bacterial lipopolysaccharide and interferon gamma. alpha-MSH inhibited production of NO, as estimated from nitrite production and nitration of endogenous macrophage proteins. This occurred through inhibition of production of NO synthase II protein; steady-state NO synthase II mRNA abundance was also reduced. alpha-MSH increased cAMP accumulation in RAW cells, characteristic of alpha-MSH receptors in other cell types. RAW cells also expressed mRNA for the primary alpha-MSH receptor (melanocortin 1). mRNA for proopiomelanocortin, the precursor molecular of alpha-MSH, was expressed in RAW cells, and tumor necrosis factor alpha increased production and release of alpha-MSH. These results suggest that the proinflammatory cytokine tumor necrosis factor alpha can induce macrophages to increase production of alpha-MSH, which then becomes available to act upon melanocortin receptors on the same cells. Such stimulation of melanocortin receptors could modulate inflammation by inhibiting the production of NO. The results suggest that alpha-MSH is an autocrine factor in macrophages which modulates inflammation by counteracting the effects of proinflammatory cytokines.

Persistent infection of rhesus macaques with T-cell-line-tropic and macrophage-tropic clones of simian/human immunodeficiency viruses (SHIV).

To elucidate the functions of human immunodeficiency virus type 1 (HIV-1) genes in a nonhuman primate model, we have constructed infectious recombinant viruses (chimeras) between the pathogenic molecular clone of simian immunodeficiency virus (SIV) SIVmac239 and molecular clones of HIV-1 that differ in phenotypic properties controlled by the env gene. HIV-1SF33 is a T-cell-line-tropic virus which induces syncytia, and HIV-1SF162 is a macrophage-tropic virus that does not induce syncytia. A DNA fragment encoding tat, rev, and env (gp160) of SIVmac239 has been replaced with the counterpart genetic region of HIV-1SF33 and HIV-1SF162 to derive chimeric recombinant simian/human immunodeficiency virus (SHIV) strains SHIVSF33 and SHIVSF162, respectively. In the acute infection stage, macaques inoculated with SHIVSF33 had levels of viremia similar to macaques infected with SIVmac239, whereas virus loads were 1/10th to 1/100th those in macaques infected with SHIVSF162. Of note is the relatively small amount of virus detected in lymph nodes of SHIVSF162-infected macaques. In the chronic infection stage, macaques infected with SHIVSF33 also showed higher virus loads than macaques infected with SHIVSF162. Virus persists for over 1 year, as demonstrated by PCR for amplification of viral DNA in all animals and by virus isolation in some animals. Antiviral antibodies, including antibodies to the HIV-1 env glycoprotein (gp160), were detected; titers of antiviral antibodies were higher in macaques infected with SHIVSF33 than in macaques infected with SHIVSF162. Although virus has persisted for over 1 year after inoculation, these animals have remained healthy with no signs of immunodeficiency. These findings demonstrate the utility of the SHIV/macaque model for analyzing HIV-1 env gene functions and for evaluating vaccines based on HIV-1 env antigens.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

The murine stk gene product, a transmembrane protein tyrosine kinase, is a receptor for macrophage-stimulating protein.

Macrophage-stimulating protein (MSP) was originally identified as an inducer of murine resident peritoneal macrophage responsiveness to chemoattractants. We recently showed that the product of RON, a protein tyrosine kinase cloned from a human keratinocyte library, is the receptor for MSP. Similarity of murine stk to RON led us to determine if the stk gene product is the murine receptor for MSP. Radiolabeled MSP could bind to NIH 3T3 cells transfected with murine stk cDNA (3T3/stk). Binding was saturable and was inhibited by unlabeled MSP but not by structurally related proteins, including hepatocyte growth factor and plasminogen. Specific binding to STK was demonstrated by cross-linking of 125I-labeled MSP to membrane proteins of 3T3/stk cells, which resulted in a protein complex with a molecular mass of 220 kDa. This radiolabeled complex comprised 125I-MSP and STK, since it could be immunoprecipitated by antibodies to the STK beta chain. Binding of MSP to stk cDNA-transfected cells induced tyrosine phosphorylation of the 150-kDa STK beta chain within 1 min and caused increased motile activity. These results establish the murine stk gene product as a specific transmembrane protein tyrosine kinase receptor for MSP. Inasmuch as the stk cDNA was cloned from a hematopoietic stem cell, our data suggest that in addition to macrophages and keratinocytes, a cell in the hematopoietic lineage may also be a target for MSP.

Expression cloning of dSR-CI, a class C macrophage-specific scavenger receptor from Drosophila melanogaster.

Mammalian class A macrophage-specific scavenger receptors (SR-A) exhibit unusually broad binding specificity for a wide variety of polyanionic ligands. The properties of these receptors suggest that they may be involved in atherosclerosis and host defense. We have previously observed a similar receptor activity in Drosophila melanogaster embryonic macrophages and in the Drosophila macrophage-like Schneider L2 cell line. Expression cloning was used to isolate from L2 cells a cDNA that encodes a third class (class C) of scavenger receptor, Drosophila SR-CI (dSR-CI). dSR-CI expression was restricted to macrophages/hemocytes during embryonic development. When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation. Although the broad polyanionic ligand-binding specificity of dSR-CI was similar to that of SR-A, their predicted protein sequences are not similar. dSR-CI is a 609-residue type I integral membrane protein containing several well-known sequence motifs, including two complement control protein (CCP) domains and somatomedin B, MAM, and mucin-like domains. Macrophage scavenger receptors apparently mediate important, well-conserved functions and may be pattern-recognition receptors that arose early in the evolution of host-defense mechanisms. Genetic and physiologic analysis of dSR-CI function in Drosophila should provide further insights into the roles played by scavenger receptors in host defense and development.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.