41 resultados para human bone
Novel human DNA alkyltransferases obtained by random substitution and genetic selection in bacteria.
Resumo:
DNA repair alkyltransferases protect organisms against the cytotoxic, mutagenic, and carcinogenic effects of alkylating agents by transferring alkyl adducts from DNA to an active cysteine on the protein, thereby restoring the native DNA structure. We used random sequence substitutions to gain structure-function information about the human O6-methylguanine-DNA methyltransferase (EC 2.1.1.63), as well as to create active mutants. Twelve codons surrounding but not including the active cysteine were replaced by a random nucleotide sequence, and the resulting random library was selected for the ability to provide alkyltransferase-deficient Escherichia coli with resistance to the methylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Few amino acid changes were tolerated in this evolutionarily conserved region of the protein. One mutation, a valine to phenylalanine change at codon 139 (V139F), was found in 70% of the selected mutants; in fact, this mutant was selected much more frequently than the wild type. V139F provided alkyltransferase-deficient bacteria with greater protection than the wild-type protein against both the cytotoxic and mutagenic effects of N-methyl-N'-nitro-N-nitrosoguanidine, increasing the D37 over 4-fold and reducing the mutagenesis rate 2.7-5.5-fold. This mutant human alkyltransferase, or others similarly created and selected, could be used to protect bone marrow cells from the cytotoxic side effects of alkylation-based chemotherapeutic regimens.
Resumo:
Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.
Resumo:
We report the three-dimensional structure of osteogenic protein 1 (OP-1, also known as bone morphogenetic protein 7) to 2.8-A resolution. OP-1 is a member of the transforming growth factor beta (TGF-beta) superfamily of proteins and is able to induce new bone formation in vivo. Members of this superfamily share sequence similarity in their C-terminal regions and are implicated in embryonic development and adult tissue repair. Our crystal structure makes possible the structural comparison between two members of the TGF-beta superfamily. We find that although there is limited sequence identity between OP-1 and TGF-beta 2, they share a common polypeptide fold. These results establish a basis for proposing the OP-1/TGF-beta 2 fold as the primary structural motif for the TGF-beta superfamily as a whole. Detailed comparison of the OP-1 and TGF-beta 2 structures has revealed striking differences that provide insights into how these growth factors interact with their receptors.
Resumo:
The chloroethylnitrosourea (CNU) alkylating agents are commonly used for cancer chemotherapy, but their usefulness is limited by severe bone marrow toxicity that causes the cumulative depletion of all hematopoietic lineages (pancytopenia). Bone marrow CNU sensitivity is probably due to the inefficient repair of CNU-induced DNA damage; relative to other tissues, bone marrow cells express extremely low levels of the O6-methylguanine DNA methyltransferase (MGMT) protein that repairs cytotoxic O6-chloroethylguanine DNA lesions. Using a simplified recombinant retroviral vector expressing the human MGMT gene under control of the phosphoglycerate kinase promoter (PGK-MGMT) we increased the capacity of murine bone marrow-derived cells to repair CNU-induced DNA damage. Stable reconstitution of mouse bone marrow with genetically modified, MGMT-expressing hematopoietic stem cells conferred considerable resistance to the cytotoxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), a CNU commonly used for chemotherapy. Bone marrow harvested from mice transplanted with PGK-MGMT-transduced cells showed extensive in vitro BCNU resistance. Moreover, MGMT expression in mouse bone marrow conferred in vivo resistance to BCNU-induced pancytopenia and significantly reduced BCNU-induced mortality due to bone marrow hypoplasia. These data demonstrate that increased DNA alkylation repair in primitive hematopoietic stem cells confers multilineage protection from the myelosuppressive effects of BCNU and suggest a possible approach to protecting cancer patients from CNU chemotherapy-related toxicity.
Resumo:
Clinical evidence of hematopoietic restoration with placental/umbilical cord blood (PCB) grafts indicates that PCB can be a useful source of hematopoietic stem cells for routine bone marrow reconstitution. In the unrelated setting, human leukocyte antigen (HLA)-matched donors must be obtained for candidate patients and, hence, large panels of frozen HLA-typed PCB units must be established. The large volume of unprocessed units, consisting mostly of red blood cells, plasma, and cryopreservation medium, poses a serious difficulty in this effort because storage space in liquid nitrogen is limited and costly. We report here that almost all the hematopoietic colony-forming cells present in PCB units can be recovered in a uniform volume of 20 ml by using rouleaux formation induced by hydroxyethyl starch and centrifugation to reduce the bulk of erythrocytes and plasma and, thus, concentrate leukocytes. This method multiples the number of units that can be stored in the same freezer space as much as 10-fold depending on the format of the storage system. We have also investigated the proportion of functional stem/progenitor cells initially present that are actually available to the recipient when thawed cryopreserved PCB units are infused. Progenitor cell viability is measurably decreased when thawed cells, still suspended in hypertonic cryopreservative solutions, are rapidly mixed with large volumes of isotonic solutions or plasma. The osmotic damage inflicted by the severe solute concentration gradient, however, can be averted by a simple 2-fold dilution after thawing, providing almost total recovery of viable hematopoietic progenitor cells.
Resumo:
PR-39 is a porcine 39-aa peptide antibiotic composed of 49% proline and 24% arginine, with an activity against Gram-negative bacteria comparable to that of tetracycline. In Escherichia coli, it inhibits DNA and protein synthesis. PR-39 was originally isolated from pig small intestine, but subsequent cDNA cloning showed that the gene is expressed in the bone marrow. The open reading frame of the clone showed that PR-39 is made as 173-aa precursor whose proregion belongs to the cathelin family. The PR39 gene, which is rather compact and spans only 1784 bp has now been sequenced. The coding information is split into four exons. The first exon contains the signal sequence of 29 residues and the first 37 residues of the cathelin propart. Exons 2 and 3 contain only cathelin information, while exon 4 codes for the four C-terminal cathelin residues and the mature PR-39 peptide extended by three residues. The sequenced upstream region (1183 bp) contains four potential recognition sites for NF-IL6 and three for APRF, transcription factors known to regulate genes for both cytokines and acute phase response factors. Genomic hybridizations revealed a fairly high level of restriction fragment length polymorphism and indicated that there are at least two copies of the PR39 gene in the pig genome. PR39 was mapped to pig chromosome 13 by linkage and in situ hybridization mapping. The gene for the human peptide antibiotic FALL-39 (also a member of the cathelin family) was mapped to human chromosome 3, which is homologous to pig chromosome 13.
Resumo:
Cells from transgenic mice expressing a human mini-gene for collagen I were used as markers to follow the fate of mesenchymal precursor cells from marrow that were partially enriched by adherence to plastic, expanded in culture, and then injected into irradiated mice. Sensitive PCR assays for the marker collagen I gene indicated that few of the donor cells were present in the recipient mice after 1 week, but 1-5 months later, the donor cells accounted for 1.5-12% of the cells in bone, cartilage, and lung in addition to marrow and spleen. A PCR in situ assay on lung indicated that the donor cells diffusely populated the parenchyma, and reverse transcription-PCR assays indicated that the marker collagen I gene was expressed in a tissue-specific manner. The results, therefore, demonstrated that mesenchymal precursor cells from marrow that are expanded in culture can serve as long-lasting precursors for mesenchymal cells in bone, cartilage, and lung. They suggest that cells may be particularly attractive targets for gene therapy ex vivo.
Resumo:
Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.
Resumo:
We have attempted to model human metastatic disease by implanting human target organs into the immunodeficient C.B-17 scid/scid (severe combined immunodeficiency; SCID) mouse, creating SCID-hu mice. Preferential metastasis to implants of human fetal lung and human fetal bone marrow occurred after i.v. injection of human small cell lung cancer (SCLC) cells into SCID-hu mice; the homologous mouse organs were spared. Clinically more aggressive variant SCLC cells metastasized more efficiently to human fetal lung implants than did cells from classic SCLC. Metastasis of variant SCLC to human fetal bone marrow was enhanced in SCID-hu mice exposed to gamma-irradiation or to interleukin 1 alpha. These data indicate that the SCID-hu mice may provide a model in which to study species- and tissue-specific steps of the human metastatic process.
Resumo:
The transcription factor NF-E2 (nuclear factor erythroid 2), interacting via DNA motifs within regulatory regions of several hematopoietic genes, is thought to mediate the enhancer activity of the globin locus control regions. By screening a human fetal liver cDNA library with probes derived from mouse NF-E2, we have isolated a splicing variant of the NF-E2 gene (fNF-E2) that differs in the 5' untranslated region from the previously reported cDNA (aNF-E2). The fNF-E2 isoform is transcribed from an alternative promoter located in the 3' end of the first intron and joined by alternative splicing to the second and third exons, which are shared by both RNA isoforms. Although the two forms produce the same protein, they are expressed in different ratios during development. fNF-E2 is more abundant in the fetal liver and less abundant in the adult bone marrow compared to the previously described form. Their distribution apparently follows the differential expression of fetal and adult hemoglobins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.