181 resultados para gene regulatory network
Resumo:
The infected cell protein no. 0 (ICP0), the product of the alpha 0 gene, and an important herpes simplex virus 1 regulatory protein is encoded by three exons. We report that intron 1 forms a family of four stable nonpolyadenylylated cytoplasmic RNAs sharing a common 5' end but differing in 3' ends. The 5' and 3' ends correspond to the accepted splice donor and four splice acceptor sites within the mapped intron domain. The most distant splice acceptor site yields the mRNA encoding the 775-aa protein known as ICP0. The mRNAs resulting from the use of alternative splice acceptor sites were also present in the cytoplasm of infected cells and would be predicted to encode proteins of 152 (ICP0-B), 87 (ICP0-C), and 90 (ICP0-D) amino acids, respectively. Both the stability of the alpha 0 mRNA and the utilization of at least one splice acceptor site was regulated by ICP22 and or US1.5 protein inasmuch as cells infected with a mutant from which these genes had been deleted accumulated smaller amounts of alpha 0 mRNA than would be predicted from the amounts of accumulated intron RNAs. In addition, one splice acceptor site was at best underutilized. These results indicate that both the splicing pattern and longevity of alpha 0 mRNA are regulated. These and other recent examples indicate that herpes simplex virus 1 regulates its own gene expression and that of the infected cells through control of mRNA splicing and longevity.
Resumo:
Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.
Resumo:
The UME6 gene of Saccharomyces cerevisiae was identified as a mitotic repressor of early meiosis-specific gene expression. It encodes a Zn2Cys6 DNA-binding protein which binds to URS1, a promoter element needed for both mitotic repression and meiotic induction of early meiotic genes. This paper demonstrates that a complete deletion of UME6 causes not only vegetative derepression of early meiotic genes during vegetative growth but also a significant reduction in induction of meiosis-specific genes, accompanied by a severe defect in meiotic progression. After initiating premeiotic DNA synthesis the vast majority of cells (approximately 85%) become arrested in prophase and fail to execute recombination; a minority of cells (approximately 15%) complete recombination and meiosis I, and half of these form asci. Quantitative analysis of the same early meiotic transcripts that are vegetatively derepressed in the ume6 mutant, SPO11, SPO13, IME2, and SPO1, indicates a low level of induction in meiosis above their vegetative derepressed levels. In addition, the expression of later meiotic transcripts, SPS2 and DIT1, is significantly delayed and reduced. The expression pattern of early meiotic genes in ume6-deleted cells is strikingly similar to that of early meiotic genes with promoter mutations in URS1. These results support the view that UME6 and URS1 are part of a developmental switch that controls both vegetative repression and meiotic induction of meiosis-specific genes.
Resumo:
Millions of people die every year in the tropical world from diseases transmitted by hematophagous insects. Failure of conventional containment measures emphasizes the need for additional approaches, such as transformation of vector insects with genes that restrict vectorial capacity. The availability of an efficient promoter to drive foreign genes in transgenic insects is a necessary tool to test the feasibility of such approach. Here we characterize the putative promoter region of a black fly midgut carboxypeptidase gene and show that these sequences correctly direct the expression of a beta-glucuronidase reporter in Drosophila melanogaster. By histochemical staining and mRNA analysis, we found that the gene is expressed strongly and gut-specifically in the transgenic Drosophila. This gut-specific black fly carboxypeptidase promoter provides a valuable tool for the study of disease vectors.
Resumo:
Steroidogenic acute regulatory protein (StAR) appears to mediate the rapid increase in pregnenolone synthesis stimulated by tropic hormones. cDNAs encoding StAR were isolated from a human adrenal cortex library. Human StAR, coexpressed in COS-1 cells with cytochrome P450scc and adrenodoxin, increased pregnenolone synthesis > 4-fold. A major StAR transcript of 1.6 kb and less abundant transcripts of 4.4 and 7.5 kb were detected in ovary and testis. Kidney had a lower amount of the 1.6-kb message. StAR mRNA was not detected in other tissues including placenta. Treatment of granulosa cells with 8-bromo-adenosine 3',5'-cyclic monophosphate for 24 hr increased StAR mRNA 3-fold or more. The structural gene encoding StAR was mapped using somatic cell hybrid mapping panels to chromosome 8p. Fluorescence in situ hybridization placed the StAR locus in the region 8p11.2. A StAR pseudogene was mapped to chromosome 13. We conclude that StAR expression is restricted to tissues that carry out mitochondrial sterol oxidations subject to acute regulation by cAMP and that StAR mRNA levels are regulated by cAMP.
Resumo:
Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.
Resumo:
Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.
Resumo:
The sulfur regulatory system of Neurospora crassa is composed of a set of structural genes involved in sulfur catabolism controlled by a genetically defined set of trans-acting regulatory genes. These sulfur regulatory genes include cys-3+, which encodes a basic region-leucine zipper transcriptional activator, and the negative regulatory gene scon-2+. We report here that the scon-2+ gene encodes a polypeptide of 650 amino acids belonging to the expanding beta-transducin family of eukaryotic regulatory proteins. Specifically, SCON2 protein contains six repeated G beta-homologous domains spanning the C-terminal half of the protein. SCON2 represents the initial filamentous fungal protein identified in the beta-transducin group. Additionally, SCON2 exhibits a specific amino-terminal domain that potentially defines another subfamily of beta-transducin homologs. Expression of the scon-2+ gene has been examined using RNA hybridization and gel mobility-shift analysis. The dependence of scon-2+ expression on CYS3 function and the binding of CYS3 to the scon-2+ promoter indicate the presence of an important control loop within the N. crassa sulfur regulatory circuit involving CYS3 activation of scon-2+ expression. On the basis of the presence of beta-transducin repeats, the crucial role of SCON2 in the signal-response pathway triggered by sulfur limitation may be mediated by protein-protein interactions.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
cAMP, through the activation of cAMP-dependent protein kinase (PKA), is involved in transcriptional regulation. In eukaryotic cells, cAMP is not considered to alter the binding affinity of CREB/ATF to cAMP-responsive element (CRE) but to induce serine phosphorylation and consequent increase in transcriptional activity. In contrast, in prokaryotic cells, cAMP enhances the DNA binding of the catabolite repressor protein to regulate the transcription of several operons. The structural similarity of the cAMP binding sites in catabolite repressor protein and regulatory subunit of PKA type II (RII) suggested the possibility of a similar role for RII in eukaryotic gene regulation. Herein we report that RIIβ subunit of PKA is a transcription factor capable of interacting physically and functionally with a CRE. In contrast to CREB/ATF, the binding of RIIβ to a CRE was enhanced by cAMP, and in addition, RIIβ exhibited transcriptional activity as a Gal4-RIIβ fusion protein. These experiments identify RIIβ as a component of an alternative pathway for regulation of CRE-directed transcription in eukaryotic cells.
Resumo:
Developmental commitment involves activation of lineage-specific genes, stabilization of a lineage-specific gene expression program, and permanent inhibition of inappropriate characteristics. To determine how these processes are coordinated in early T cell development, the expression of T and B lineage-specific genes was assessed in staged subsets of immature thymocytes. T lineage characteristics are acquired sequentially, with germ-line T cell antigen receptor-β transcripts detected very early, followed by CD3ɛ and terminal deoxynucleotidyl transferase, then pTα, and finally RAG1. Only RAG1 expression coincides with commitment. Thus, much T lineage gene expression precedes commitment and does not depend on it. Early in the course of commitment to the T lineage, thymocytes lose the ability to develop into B cells. To understand how this occurs, we also examined expression of well defined B lineage-specific genes. Although λ5 and Ig-α are not expressed, the μ0 and Iμ transcripts from the unrearranged IgH locus are expressed early, in distinct patterns, then repressed just before RAG1 expression. By contrast, RNA encoding the B cell receptor component Ig-β was found to be transcribed in all immature thymocyte subpopulations and throughout most thymocyte differentiation. Ig-β expression is down-regulated only during positive selection of CD4+CD8– cells. Thus several key participants in the B cell developmental program are expressed in non-B lineage-committed cells, and one is maintained even through commitment to an alternative lineage, and repressed only after extensive T lineage differentiation. The results show that transcriptional activation of “lymphocyte-specific” genes can occur in uncommitted precursors, and that T lineage commitment is a composite of distinct positive and negative regulatory events.
Resumo:
Varicella-Zoster virus (VZV) is a herpesvirus that becomes latent in sensory neurons after primary infection (chickenpox) and subsequently may reactivate to cause zoster. The mechanism by which this virus maintains latency, and the factors involved, are poorly understood. Here we demonstrate, by immunohistochemical analysis of ganglia obtained at autopsy from seropositive patients without clinical symptoms of VZV infection that viral regulatory proteins are present in latently infected neurons. These proteins, which localize to the nucleus of cells during lytic infection, predominantly are detected in the cytoplasm of latently infected neurons. The restriction of regulatory proteins from the nucleus of latently infected neurons might interrupt the cascade of virus gene expression that leads to a productive infection. Our findings raise the possibility that VZV has developed a novel mechanism for maintenance of latency that contrasts with the transcriptional repression that is associated with latency of herpes simplex virus, the prototypic alpha herpesvirus.
Resumo:
Oxidation of molecular hydrogen catalyzed by [NiFe] hydrogenases is a widespread mechanism of energy generation among prokaryotes. Biosynthesis of the H2-oxidizing enzymes is a complex process subject to positive control by H2 and negative control by organic energy sources. In this report we describe a novel signal transduction system regulating hydrogenase gene (hox) expression in the proteobacterium Alcaligenes eutrophus. This multicomponent system consists of the proteins HoxB, HoxC, HoxJ*, and HoxA. HoxB and HoxC share characteristic features of dimeric [NiFe] hydrogenases and form the putative H2 receptor that interacts directly or indirectly with the histidine protein kinase HoxJ*. A single amino acid substitution (HoxJ*G422S) in a conserved C-terminal glycine-rich motif of HoxJ* resulted in a loss of H2-dependent signal transduction and a concomitant block in autophosphorylating activity, suggesting that autokinase activity is essential for the response to H2. Whereas deletions in hoxB or hoxC abolished hydrogenase synthesis almost completely, the autokinase-deficient strain maintained high-level hox gene expression, indicating that the active sensor kinase exerts a negative effect on hox gene expression in the absence of H2. Substitutions of the conserved phosphoryl acceptor residue Asp55 in the response regulator HoxA (HoxAD55E and HoxAD55N) disrupted the H2 signal-transduction chain. Unlike other NtrC-like regulators, the altered HoxA proteins still allowed high-level transcriptional activation. The data presented here suggest a model in which the nonphosphorylated form of HoxA stimulates transcription in concert with a yet unknown global energy-responsive factor.
Resumo:
Hepatic glucokinase plays a key role in glucose metabolism as underlined by the anomalies associated with glucokinase mutations and the consequences of tissue-specific knock-out. In the liver, glucokinase transcription is absolutely dependent on the presence of insulin. The cis-elements and trans-acting factors that mediate the insulin effect are presently unknown; this is also the case for most insulin-responsive genes. We have shown previously that the hepatic expression of the transcription factor sterol regulatory element binding protein-1c (SREBP-1c) is activated by insulin. We show here in primary cultures of hepatocytes that the adenovirus-mediated transduction of a dominant negative form of SREBP-1c inhibits the insulin effect on endogenous glucokinase expression. Conversely, in the absence of insulin, the adenovirus-mediated transduction of a dominant positive form of SREBP-1c overcomes the insulin dependency of glucokinase expression. Hepatic fatty acid synthase and Spot-14 are insulin/glucose-dependent genes. For this latter class of genes, the dominant positive form of SREBP-1c obviates the necessity for the presence of insulin, whereas glucose potentiates the effect of SREBP-1c on their expression. In addition, the insulin dependency of lipid accumulation in cultured hepatocytes is overcome by the dominant positive form of SREBP-1c. We propose that SREBP-1c is a major mediator of insulin action on hepatic gene expression and a key regulator of hepatic glucose/lipid metabolism.
Resumo:
Paroxysmal nocturnal hemoglobinuria (PNH) is a clonal hematopoietic stem cell disorder resulting from mutations in an X-linked gene, PIG-A, that encodes an enzyme required for the first step in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. PIG-A mutations result in absent or decreased cell surface expression of all GPI-anchored proteins. Although many of the clinical manifestations (e.g., hemolytic anemia) of the disease can be explained by a deficiency of GPI-anchored complement regulatory proteins such as CD59 and CD55, it is unclear why the PNH clone dominates hematopoiesis and why it is prone to evolve into acute leukemia. We found that PIG-A mutations confer a survival advantage by making cells relatively resistant to apoptotic death. When placed in serum-free medium, granulocytes and affected CD34+ (CD59−) cells from PNH patients survived longer than their normal counterparts. PNH cells were also relatively resistant to apoptosis induced by ionizing irradiation. Replacement of the normal PIG-A gene in PNH cell lines reversed the cellular resistance to apoptosis. Inhibited apoptosis resulting from PIG-A mutations appears to be the principle mechanism by which PNH cells maintain a growth advantage over normal progenitors and could play a role in the propensity of this disease to transform into more aggressive hematologic disorders. These data also suggest that GPI anchors are important in regulating apoptosis.