Blood-borne tissue factor: Another view of thrombosis

Arterial thrombosis is considered to arise from the interaction of tissue factor (TF) in the vascular wall with platelets and coagulation factors in circulating blood. According to this paradigm, coagulation is initiated after a vessel is damaged and blood is exposed to vessel-wall TF. We have examined thrombus formation on pig arterial media (which contains no stainable TF) and on collagen-coated glass slides (which are devoid of TF) exposed to flowing native human blood. In both systems the thrombi that formed during a 5-min perfusion stained intensely for TF, much of which was not associated with cells. Antibodies against TF caused ≈70% reduction in the amount of thrombus formed on the pig arterial media and also reduced thrombi on the collagen-coated glass slides. TF deposited on the slides was active, as there was abundant fibrin in the thrombi. Factor VIIai, a potent inhibitor of TF, essentially abolished fibrin production and markedly reduced the mass of the thrombi. Immunoelectron microscopy revealed TF-positive membrane vesicles that we frequently observed in large clusters near the surface of platelets. TF, measured by factor Xa formation, was extracted from whole blood and plasma of healthy subjects. By using immunostaining, TF-containing neutrophils and monocytes were identified in peripheral blood; our data raise the possibility that leukocytes are the main source of blood TF. We suggest that blood-borne TF is inherently thrombogenic and may be involved in thrombus propagation at the site of vascular injury.

A potential role for the nuclear factor of activated T cells family of transcriptional regulatory proteins in adipogenesis

NFAT (nuclear factor of activated T cells) is a family of transcription factors implicated in the control of cytokine and early immune response gene expression. Recent studies have pointed to a role for NFAT proteins in gene regulation outside of the immune system. Herein we demonstrate that NFAT proteins are present in 3T3-L1 adipocytes and, upon fat cell differentiation, bind to and transactivate the promoter of the adipocyte-specific gene aP2. Further, fat cell differentiation is inhibited by cyclosporin A, a drug shown to prevent NFAT nuclear localization and hence function. Thus, these data suggest a role for NFAT transcription factors in the regulation of the aP2 gene and in the process of adipocyte differentiation.

Polymorphism in the 3′-untranslated region of TNFα mRNA impairs binding of the post-transcriptional regulatory protein HuR to TNFα mRNA

Tumor necrosis factor α (TNFα) acts as a beneficial mediator in the process of host defence. In recent years major interest has focused on the AU-rich elements (AREs) present in the 3′-untranslated region (3′-UTR) of TNFα mRNA as this region plays a pivotal role in post-transcriptional control of TNFα production. Certain stimuli, such as lipopolysaccharides, a component of the Gram-negative bacterial cell wall, have the ability to relinquish the translational suppression of TNFα mRNA imposed by these AREs in macrophages, thereby enabling the efficient production of the TNFα. In this study we show that the polymorphism (GAU trinucleotide insertional mutation) present in the regulatory 3′-UTR of TNFα mRNA of NZW mice results in the hindered binding of RNA-binding proteins, thereby leading to a significantly reduced production of TNFα protein. We also show that the binding of macrophage proteins to the main ARE is also decreased by another trinucleotide (CAU) insertion in the TNFα 3′-UTR. One of the proteins affected by the GAU trinucleotide insertional mutation was identified as HuR, a nucleo-cytoplasmic shuttling protein previously shown to play a prominent role in the stability and translatability of mRNA containing AREs. Since binding of this protein most likely modulates the stability, translational efficiency and transport of TNFα mRNA, these results suggest that mutations in the ARE of TNFα mRNA decrease the production of TNFα protein in macrophages by hindering the binding of HuR to the ARE.

Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor

The corticotropin-releasing factor (CRF) family of neuropeptides includes the mammalian peptides CRF, urocortin, and urocortin II, as well as piscine urotensin I and frog sauvagine. The mammalian peptides signal through two G protein-coupled receptor types to modulate endocrine, autonomic, and behavioral responses to stress, as well as a range of peripheral (cardiovascular, gastrointestinal, and immune) activities. The three previously known ligands are differentially distributed anatomically and have distinct specificities for the two major receptor types. Here we describe the characterization of an additional CRF-related peptide, urocortin III, in the human and mouse. In searching the public human genome databases we found a partial expressed sequence tagged (EST) clone with significant sequence identity to mammalian and fish urocortin-related peptides. By using primers based on the human EST sequence, a full-length human clone was isolated from genomic DNA that encodes a protein that includes a predicted putative 38-aa peptide structurally related to other known family members. With a human probe, we then cloned the mouse ortholog from a genomic library. Human and mouse urocortin III share 90% identity in the 38-aa putative mature peptide. In the peptide coding region, both human and mouse urocortin III are 76% identical to pufferfish urocortin-related peptide and more distantly related to urocortin II, CRF, and urocortin from other mammalian species. Mouse urocortin III mRNA expression is found in areas of the brain including the hypothalamus, amygdala, and brainstem, but is not evident in the cerebellum, pituitary, or cerebral cortex; it is also expressed peripherally in small intestine and skin. Urocortin III is selective for type 2 CRF receptors and thus represents another potential endogenous ligand for these receptors.

A human homologue of the Drosophila sex determination factor transformer-2 has conserved splicing regulatory functions.

Regulation of gene expression through alternative pre-mRNA splicing appears to occur in all metazoans, but most of our knowledge about splicing regulators derives from studies on genetically identified factors from Drosophila. Among the best studied of these is the transformer-2 (TRA-2) protein which, in combination with the transformer (TRA) protein, directs sex-specific splicing of pre-mRNA from the sex determination gene doublesex (dsx). Here we report the identification of htra-2 alpha, a human homologue of tra-2. Two alternative types of htra-2 alpha cDNA clones were identified that encode different protein isoforms with striking organizational similarity to Drosophila tra-2 proteins. When expressed in flies, one hTRA-2 alpha isoform partially replaces the function of Drosophila TRA-2, affecting both female sexual differentiation and alternative splicing of dsx pre-mRNA. Like Drosophila TRA-2, the ability of hTRA-2 alpha to regulate dsx is female-specific and depends on the presence of the dsx splicing enhancer. These results demonstrate that htra-2 alpha has conserved a striking degree of functional specificity during evolution and leads us to suggest that, although they are likely to serve different roles in development, the tra-2 products of flies and humans have similar molecular functions.

Identification of the zinc-dependent endothelial cell binding protein for high molecular weight kininogen and factor XII: identity with the receptor that binds to the globular "heads" of C1q (gC1q-R).

High molecular weight kininogen (HK) and factor XII are known to bind to human umbilical vein endothelial cells (HUVEC) in a zinc-dependent and saturable manner indicating that HUVEC express specific binding site(s) for those proteins. However, identification and immunochemical characterization of the putative receptor site(s) has not been previously accomplished. In this report, we have identified a cell surface glycoprotein that is a likely candidate for the HK binding site on HUVECs. When solubilized HUVEC membranes were subjected to an HK-affinity column in the presence or absence of 50 microM ZnCl2 and the bound membrane proteins eluted, a single major protein peak was obtained only in the presence of zinc. SDS/PAGE analysis and silver staining of the protein peak revealed this protein to be 33 kDa and partial sequence analysis matched the NH2 terminus of gC1q-R, a membrane glycoprotein that binds to the globular "heads" of C1q. Two other minor proteins of approximately 70 kDa and 45 kDa were also obtained. Upon analysis by Western blotting, the 33-kDa band was found to react with several monoclonal antibodies (mAbs) recognizing different epitopes on gC1q-R. Ligand and dot blot analyses revealed zinc-dependent binding of biotinylated HK as well as biotinylated factor XII to the isolated 33-kDa HUVEC molecule as well as recombinant gC1q-R. In addition, binding of 125I-HK to HUVEC cells was inhibited by selected monoclonal anti-gC1q-R antibodies. C1q, however, did not inhibit 125I-HK binding to HUVEC nor did those monoclonals known to inhibit C1q binding to gC1q-R. Taken together, the data suggest that HK (and factor XII) bind to HUVECs via a 33-kDa cell surface glycoprotein that appears to be identical to gC1q-R but interact with a site on gC1q-R distinct from that which binds C1q.

An essential regulatory role for macrophage migration inhibitory factor in T-cell activation.

The protein known as macrophage migration inhibitory factor (MIF) was one of the first cytokines to be discovered and was described 30 years ago to be a T-cell-derived factor that inhibited the random migration of macrophages in vitro. A much broader role for MIF has emerged recently as a result of studies that have demonstrated it to be released from the anterior pituitary gland in vivo. MIF also is the first protein that has been identified to be secreted from monocytes/macrophages upon glucocorticoid stimulation. Once released, MIF acts to "override" or counter-regulate the suppressive effects of glucocorticoids on macrophage cytokine production. We report herein that MIF plays an important regulatory role in the activation of T cells induced by mitogenic or antigenic stimuli. Activated T cells produce MIF and neutralizing anti-MIF antibodies inhibit T-cell proliferation and interleukin 2 production in vitro, and suppress antigen-driven T-cell activation and antibody production in vivo. T cells also release MIF in response to glucocorticoid stimulation and MIF acts to override glucocorticoid inhibition of T-cell proliferation and interleukin 2 and interferon gamma production. These studies indicate that MIF acts in concert with glucocorticoids to control T-cell activation and assign a previously unsuspected but critical role for MIF in antigen-specific immune responses.

Complexity of the erythroid transcription factor NF-E2 as revealed by gene targeting of the mouse p18 NF-E2 locus.

High-level globin expression in erythroid precursor cells depends on the integrity of NF-E2 recognition sites, transcription factor AP-1-like protein-binding motifs, located in the upstream regulatory regions of the alpha- and beta-globin loci. The NF-E2 transcription factor, which recognizes these sites, is a heterodimer consisting of (i) p45 NF-E2 (the larger subunit), a hematopoietic-restricted basic leucine zipper protein, and (ii) a widely expressed basic leucine zipper factor, p18 NF-E2, the smaller subunit. p18 NF-E2 protein shares extensive homology with the maf protooncogene family. To determine an in vivo role for p18 NF-E2 protein we disrupted the p18 NF-E2-encoding gene by homologous recombination in murine embryonic stem cells and generated p18 NF-E2-/- mice. These mice are indistinguishable from littermates throughout all phases of development and remain healthy in adulthood. Despite the absence of expressed p18 NF-E2, DNA-binding activity with the properties of the NF-E2 heterodimer is present in fetal liver erythroid cells of p18 NF-E2-/- mice. We speculate that another member of the maf basic leucine zipper family substitutes for the p18 subunit in a complex with p45 NF-E2. Thus, p18 NF-E2 per se appears to be dispensable in vivo.

Opposing early and late effects of insulin-like growth factor I on differentiation and the cell cycle regulatory retinoblastoma protein in skeletal myoblasts.

The mechanisms by which insulin-like growth factors (IGFs) can be both mitogenic and differentiation-promoting in skeletal myoblasts are unclear because these two processes are believed to be mutually exclusive in this tissue. The phosphorylation state of the ubiquitous nuclear retinoblastoma protein (Rb) plays an important role in determining whether myoblasts proliferate or differentiate: Phosphorylated Rb promotes mitogenesis, whereas un- (or hypo-) phosphorylated Rb promotes cell cycle exit and differentiation. We hypothesized that IGFs might affect the fate of myoblasts by regulating the phosphorylation of Rb. Although long-term IGF treatment is known to stimulate differentiation, we find that IGFs act initially to inhibit differentiation and are exclusively mitogenic. These early effects of IGFs are associated with maintenance of Rb phosphorylation typical of proliferating cells; upregulation of the gene expression of cyclin-dependent kinase 4 and cyclin D1, components of a holoenzyme that plays a principal role in mediating Rb phosphorylation; and marked inhibition of the gene expression of myogenin, a member of the MyoD family of skeletal muscle-specific transcription factors that is essential in muscle differentiation. We also find that IGF-induced inhibition of differentiation occurs through a process that is independent of its mitogenic effects. We demonstrate, thus, that IGFs regulate Rb phosphorylation and cyclin D1 and cyclin-dependent kinase 4 gene expression; together with their biphasic effects on myogenin expression, these results suggest a mechanism by which IGFs are initially mitogenic and subsequently differentiation-promoting in skeletal muscle.

Domains of transcription factor Sp1 required for synergistic activation with sterol regulatory element binding protein 1 of low density lipoprotein receptor promoter.

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

The ATX1 gene of Saccharomyces cerevisiae encodes a small metal homeostasis factor that protects cells against reactive oxygen toxicity.

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. Here we describe the isolation and characterization of another gene in the yeast Saccharomyces cerevisiae that plays a critical role in detoxification of reactive oxygen species. This gene, named ATX1, was originally isolated by its ability to suppress oxygen toxicity in yeast lacking SOD. ATX1 encodes a 8.2-kDa polypeptide exhibiting significant similarity and identity to various bacterial metal transporters. Potential ATX1 homologues were also identified in multicellular eukaryotes, including the plants Arabidopsis thaliana and Oryza sativa and the nematode Caenorhabditis elegans. In yeast cells, ATX1 evidently acts in the transport and/or partitioning of copper, and this role in copper homeostasis appears to be directly relevant to the ATX1 suppression of oxygen toxicity: ATX1 was incapable of compensating for SOD when cells were depleted of exogenous copper. Strains containing a deletion in the chromosomal ATX1 locus were generated. Loss of ATX1 function rendered both mutant and wild-type SOD strains hypersensitive toward paraquat (a generator of superoxide anion) and was also associated with an increased sensitivity toward hydrogen peroxide. Hence, ATX1 protects cells against the toxicity of both superoxide anion and hydrogen peroxide.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.