Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription.

The penicillin gene cluster is amplified in tandem repeats linked by conserved hexanucleotide sequences.

The penicillin biosynthetic genes (pcbAB, pcbC, penDE) of Penicillium chrysogenum AS-P-78 were located in a 106.5-kb DNA region that is amplified in tandem repeats (five or six copies) linked by conserved TTTACA sequences. The wild-type strains P. chrysogenum NRRL 1951 and Penicillium notatum ATCC 9478 (Fleming's isolate) contain a single copy of the 106.5-kb region. This region was bordered by the same TTTACA hexanucleotide found between tandem repeats in strain AS-P-78. A penicillin overproducer strain, P. chrysogenum E1, contains a large number of copies in tandem of a 57.9-kb DNA fragment, linked by the same hexanucleotide or its reverse complementary TGTAAA sequence. The deletion mutant P. chrysogenum npe10 showed a deletion of 57.9 kb that corresponds exactly to the DNA fragment that is amplified in E1. The conserved hexanucleotide sequence was reconstituted at the deletion site. The amplification has occurred within a single chromosome (chromosome I). The tandem reiteration and deletion appear to arise by mutation-induced site-specific recombination at the conserved hexanucleotide sequences.

The su(Hw) protein bound to gypsy sequences in one chromosome can repress enhancer-promoter interactions in the paired gene located in the other homolog.

The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Vibrio cholerae O1 El Tor: Identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation

The rugose colony variant of Vibrio cholerae O1, biotype El Tor, is shown to produce an exopolysaccharide, EPSETr, that confers chlorine resistance and biofilm-forming capacity. EPSETr production requires a chromosomal locus, vps, that contains sequences homologous to carbohydrate biosynthesis genes of other bacterial species. Mutations within this locus yield chlorine-sensitive, smooth colony variants that are biofilm deficient. The biofilm-forming properties of EPSETr may enable the survival of V. cholerae O1 within environmental aquatic habitats between outbreaks of human disease.

Functional copies of a human gene can be directly isolated by transformation-associated recombination cloning with a small 3′ end target sequence

Unique, small sequences (sequence tag sites) have been identified at the 3′ ends of most human genes that serve as landmarks in genome mapping. We investigated whether a single copy gene could be isolated directly from total human DNA by transformation-associated recombination (TAR) cloning in yeast using a short, 3′ unique target. A TAR cloning vector was constructed that, when linearized, contained a small amount (381 bp) of 3′ hypoxanthine phosphoribosyltransferase (HPRT) sequence at one end and an 189-bp Alu repeat at the other end. Transformation with this vector along with human DNA led to selective isolations of the entire HPRT gene as yeast artificial chromosomes (YACs) that extended from the 3′ end sequence to various Alu positions as much as 600 kb upstream. These YACs were retrofitted with a NeoR and a bacterial artificial chromosome (BAC) sequence to transfer the YACs to bacteria and subsequently the BACs to mouse cells by using a Neo selection. Most of the HPRT isolates were functional, demonstrating that TAR cloning retains the functional integrity of the isolated material. Thus, this modified version of TAR cloning, which we refer to as radial TAR cloning, can be used to isolate large segments of the human genome accurately and directly with only a small amount of sequence information.

In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis

We have developed a technique, methylation-specific PCR in situ hybridization (MSP-ISH), which allows for the methylation status of specific DNA sequences to be visualized in individual cells. We use MSP-ISH to monitor the timing and consequences of aberrant hypermethylation of the p16 tumor suppresser gene during the progression of cancers of the lung and cervix. Hypermethylation of p16 was localized only to the neoplastic cells in both in situ lesions and invasive cancers, and was associated with loss of p16 protein expression. MSP-ISH allowed us to dissect the surprising finding that p16 hypermethylation occurs in cervical carcinoma. This tumor is associated with infection of the oncogenic human papillomavirus, which expresses a protein, E7, that inactivates the retinoblastoma (Rb) protein. Thus, simultaneous Rb and p16 inactivation would not be needed to abrogate the critical cyclin D–Rb pathway. MSP-ISH reveals that p16 hypermethylation occurs heterogeneously within early cervical tumor cell populations that are separate from those expressing viral E7 transcripts. In advanced cervical cancers, the majority of cells have a hypermethylated p16, lack p16 protein, but no longer express E7. These data suggest that p16 inactivation is selected as the most effective mechanism of blocking the cyclin D–Rb pathway during the evolution of an invasive cancer from precursor lesions. These studies demonstrate that MSP-ISH is a powerful approach for studying the dynamics of aberrant methylation of critical tumor suppressor genes during tumor evolution.

Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons

The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes.

Transcription initiation is controlled by three core promoter elements in the hgl5 gene of the protozoan parasite Entamoeba histolytica

Entamoeba histolytica is a single cell eukaryote that is the etiologic agent of amoebic colitis. Core promoter elements of E. histolytica protein encoding genes include a TATA-like sequence (GTATTTAAAG/C) at −30, a novel element designated GAAC (GAACT) that has a variable location between TATA and the site of transcription initiation, and a putative initiator (Inr) element (AAAAATTCA) overlying the site of transcription initiation. The presence of three separate conserved sequences in a eukaryotic core promoter is unprecedented and prompted examination of their roles in regulating transcription initiation. Alterations of all three regions in the hgl5 gene decreased reporter gene activity with the greatest effect seen by mutation of the GAAC element. Positional analysis of the TATA box demonstrated that transcription initiated consistently 30–31 bases downstream of the TATA region. Mutation of either the TATA or GAAC elements resulted in the appearance of new transcription start sites upstream of +1 in the promoter of the hgl5 gene. Mutation of the Inr element resulted in no change in the site of transcription initiation; however, in the presence of a mutated TATA and GAAC regions, the Inr element controlled the site of transcription initiation. We conclude that all three elements play a role in determining the site of transcription initiation. The variable position of the GAAC element relative to the site of transcription initiation, and the multiple transcription initiations that resulted from its mutation, indicate that the GAAC element has an important and apparently novel role in transcriptional control in E. histolytica.

Mendel’s dwarfing gene: cDNAs from the Le alleles and function of the expressed proteins

The major gibberellin (GA) controlling stem elongation in pea (Pisum sativum L.) is GA1, which is formed from GA20 by 3β-hydroxylation. This step, which limits GA1 biosynthesis in pea, is controlled by the Le locus, one of the original Mendelian loci. Mutations in this locus result in dwarfism. We have isolated cDNAs encoding a GA 3β-hydroxylase from lines of pea carrying the Le, le, le-3, and led alleles. The cDNA sequences from le and le-3 each contain a base substitution resulting in single amino acid changes relative to the sequence from Le. The cDNA sequence from led, a mutant derived from an le line, contains both the le “mutation” and a single-base deletion, which causes a shift in reading frame and presumably a null mutation. cDNAs from each line were expressed in Escherichia coli. The expression product for the clone from Le converted GA9 to GA4, and GA20 to GA1, with Km values of 1.5 μM and 13 μM, respectively. The amino acid substitution in the clone from le increased Km for GA9 100-fold and reduced conversion of GA20 to almost nil. Expression products from le and le-3 possessed similar levels of 3β-hydroxylase activity, and the expression product from led was inactive. Our results suggest that the 3β-hydroxylase cDNA is encoded by Le. Le transcript is expressed in roots, shoots, and cotyledons of germinating pea seedlings, in internodes and leaves of established seedlings, and in developing seeds.

Transcriptional regulation of the Xlim-1 gene by activin is mediated by an element in intron I

The Xlim-1 gene is activated in the late blastula stage of Xenopus embryogenesis in the mesoderm, and its RNA product becomes concentrated in the Spemann organizer at early gastrula stage. A major regulator of early expression of Xlim-1 is activin or an activin-like signal. We report experiments aiming to identify the activin response element in the Xlim-1 gene. The 5′ flanking region of the gene contains a constitutive promoter that is not activin responsive, whereas sequences in the first intron mediate repression of basal promoter activity and stimulation by activin. An intron-derived fragment of 212 nt is the smallest element that could mediate activin responsiveness. Nodal and act-Vg1, factors with signaling properties similar to activin, also stimulated Xlim-1 reporter constructs, whereas BMP-4 did not stimulate or repress the constructs. The mechanism of activin regulation of Xlim-1 and the sequence of the response element are distinct from activin response elements of other genes studied so far.

Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination

One-third of humans are infected with Mycobacterium tuberculosis, the causative agent of tuberculosis. Sequence analysis of two megabases in 26 structural genes or loci in strains recovered globally discovered a striking reduction of silent nucleotide substitutions compared with other human bacterial pathogens. The lack of neutral mutations in structural genes indicates that M. tuberculosis is evolutionarily young and has recently spread globally. Species diversity is largely caused by rapidly evolving insertion sequences, which means that mobile element movement is a fundamental process generating genomic variation in this pathogen. Three genetic groups of M. tuberculosis were identified based on two polymorphisms that occur at high frequency in the genes encoding catalase-peroxidase and the A subunit of gyrase. Group 1 organisms are evolutionarily old and allied with M. bovis, the cause of bovine tuberculosis. A subset of several distinct insertion sequence IS6110 subtypes of this genetic group have IS6110 integrated at the identical chromosomal insertion site, located between dnaA and dnaN in the region containing the origin of replication. Remarkably, study of ≈6,000 isolates from patients in Houston and the New York City area discovered that 47 of 48 relatively large case clusters were caused by genotypic group 1 and 2 but not group 3 organisms. The observation that the newly emergent group 3 organisms are associated with sporadic rather than clustered cases suggests that the pathogen is evolving toward a state of reduced transmissability or virulence.

The mouse histone H2a gene contains a small element that facilitates cytoplasmic accumulation of intronless gene transcripts and of unspliced HIV-1-related mRNAs

Histone mRNAs are naturally intronless and accumulate efficiently in the cytoplasm. To learn whether there are cis-acting sequences within histone genes that allow efficient cytoplasmic accumulation of RNAs, we made recombinant constructs in which sequences from the mouse H2a gene were cloned into a human β-globin cDNA. By using transient transfection and RNase protection analysis, we demonstrate here that a 100-bp sequence within the H2a coding region permits efficient cytoplasmic accumulation of the globin cDNA transcripts. We also show that this sequence appears to suppress splicing and can functionally replace Rev and the Rev-responsive element in the cytoplasmic accumulation of unspliced HIV-1-related mRNAs. Like the Rev-responsive element, this sequence acts in an orientation-dependent manner. We thus propose that the sequence identified here may be a member of the cis-acting elements that facilitate the cytoplasmic accumulation of naturally intronless gene transcripts.

The atypical codon usage of the plant psbA gene may be the remnant of an ancestral bias

The psbA gene of the chloroplast genome has a codon usage that is unusual for plant chloroplast genes. In the present study the evolutionary status of this codon usage is tested by reconstructing putative ancestral psbA sequences to determine the pattern of change in codon bias during angiosperm divergence. It is shown that the codon biases of the ancestral genes are much stronger than all extant flowering plant psbA genes. This is related to previous work that demonstrated a significant increase in synonymous substitution in psbA relative to other chloroplast genes. It is suggested, based on the two lines of evidence, that the codon bias of this gene currently is not being maintained by selection. Rather, the atypical codon bias simply may be a remnant of an ancestral codon bias that now is being degraded by the mutation bias of the chloroplast genome, in other words, that the psbA gene is not at equilibrium. A model for the evolution of selective pressure on the codon usage of plant chloroplast genes is discussed.

Fluorescence in situ hybridization analysis of keratinocyte growth factor gene amplification and dispersion in evolution of great apes and humans

Keratinocyte growth factor (KGF) is a member of the fibroblast growth factor family. Portions of the gene encoding KGF were amplified during primate evolution and are present in multiple nonprocessed copies in the human genome. Nucleotide analysis of a representative sampling of these KGF-like sequences indicated that they were at least 95% identical to corresponding regions of the KGF gene. To localize these sequences to specific chromosomal sites in human and higher primates, we used fluorescence in situ hybridization. In human, using a cosmid probe encoding KGF exon 1, we assigned the location of the KGF gene to chromosome 15q15–21.1. In addition, copies of KGF-like sequences hybridizing only with a cosmid probe encoding exons 2 and 3 were localized to dispersed sites on chromosome 2q21, 9p11, 9q12–13, 18p11, 18q11, 21q11, and 21q21.1. The distribution of KGF-like sequences suggests a role for alphoid DNA in their amplification and dispersion. In chimpanzee, KGF-like sequences were observed at five chromosomal sites, which were each homologous to sites in human, while in gorilla, a subset of four of these homologous sites was identified; in orangutan two sites were identified, while gibbon exhibited only a single site. The chromosomal localization of KGF sequences in human and great ape genomes indicates that amplification and dispersion occurred in multiple discrete steps, with initial KGF gene duplication and dispersion taking place in gibbon and involving loci corresponding to human chromosomes 15 and 21. These findings support the concept of a closer evolutionary relationship of human and chimpanzee and a possible selective pressure for such dispersion during the evolution of higher primates.