33 resultados para Foundation colony
Resumo:
We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.
Resumo:
Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.