125 resultados para regulatory T-cell homeostasis
Resumo:
Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
CREB, the cAMP response element binding protein, is a key transcriptional regulator of a large number of genes containing a CRE consensus sequence in their upstream regulatory regions. Mice with a hypomorphic allele of CREB that leads to a loss of the CREBα and Δ isoforms and to an overexpression of the CREBβ isoform are viable. Herein we report the generation of CREB null mice, which have all functional isoforms (CREBα, β, and Δ) inactivated. In contrast to the CREBαΔ mice, CREB null mice are smaller than their littermates and die immediately after birth from respiratory distress. In brain, a strong reduction in the corpus callosum and the anterior commissures is observed. Furthermore, CREB null mice have an impaired fetal T cell development of the αβ lineage, which is not affected in CREBαΔ mice on embryonic day 18.5. Overall thymic cellularity in CREB null mice is severely reduced affecting all developmental stages of the αβ T cell lineage. In contrast γδ T cell differentiation is normal in CREB mutant mice.
Resumo:
Developmental commitment involves activation of lineage-specific genes, stabilization of a lineage-specific gene expression program, and permanent inhibition of inappropriate characteristics. To determine how these processes are coordinated in early T cell development, the expression of T and B lineage-specific genes was assessed in staged subsets of immature thymocytes. T lineage characteristics are acquired sequentially, with germ-line T cell antigen receptor-β transcripts detected very early, followed by CD3ɛ and terminal deoxynucleotidyl transferase, then pTα, and finally RAG1. Only RAG1 expression coincides with commitment. Thus, much T lineage gene expression precedes commitment and does not depend on it. Early in the course of commitment to the T lineage, thymocytes lose the ability to develop into B cells. To understand how this occurs, we also examined expression of well defined B lineage-specific genes. Although λ5 and Ig-α are not expressed, the μ0 and Iμ transcripts from the unrearranged IgH locus are expressed early, in distinct patterns, then repressed just before RAG1 expression. By contrast, RNA encoding the B cell receptor component Ig-β was found to be transcribed in all immature thymocyte subpopulations and throughout most thymocyte differentiation. Ig-β expression is down-regulated only during positive selection of CD4+CD8– cells. Thus several key participants in the B cell developmental program are expressed in non-B lineage-committed cells, and one is maintained even through commitment to an alternative lineage, and repressed only after extensive T lineage differentiation. The results show that transcriptional activation of “lymphocyte-specific” genes can occur in uncommitted precursors, and that T lineage commitment is a composite of distinct positive and negative regulatory events.
Resumo:
Photodynamic therapy (PDT) is a promising new modality that utilizes a combination of a photosensitizing chemical and visible light for the management of a variety of solid malignancies. The mechanism of PDT-mediated cell killing is not well defined. We investigated the involvement of cell cycle regulatory events during silicon phthalocyanine (Pc4)-PDT-mediated apoptosis in human epidermoid carcinoma cells A431. PDT resulted in apoptosis, inhibition of cell growth, and G0-G1 phase arrest of the cell cycle, in a time-dependent fashion. Western blot analysis revealed that PDT results in an induction of the cyclin kinase inhibitor WAF1/CIP1/p21, and a down-regulation of cyclin D1 and cyclin E, and their catalytic subunits cyclin-dependent kinase (cdk) 2 and cdk6. The treatment also resulted in a decrease in kinase activities associated with all the cdks and cyclins examined. PDT also resulted in (i) an increase in the binding of cyclin D1 and cdk6 toward WAF1/CIP1/p21, and (ii) a decrease in the binding of cyclin D1 toward cdk2 and cdk6. The binding of cyclin E and cdk2 toward WAF1/CIP1/p21, and of cyclin E toward cdk2 did not change by the treatment. These data suggest that PDT-mediated induction of WAF1/CIP1/p21 results in an imposition of artificial checkpoint at G1 → S transition thereby resulting in an arrest of cells in G0-G1 phase of the cell cycle through inhibition in the cdk2, cdk6, cyclin D1, and cyclin E. We suggest that this arrest is an irreversible process and the cells, unable to repair the damages, ultimately undergo apoptosis.
Resumo:
ATP-sensitive potassium (KATP) channels in the pancreatic β cell membrane mediate insulin release in response to elevation of plasma glucose levels. They are open at rest but close in response to glucose metabolism, producing a depolarization that stimulates Ca2+ influx and exocytosis. Metabolic regulation of KATP channel activity currently is believed to be mediated by changes in the intracellular concentrations of ATP and MgADP, which inhibit and activate the channel, respectively. The β cell KATP channel is a complex of four Kir6.2 pore-forming subunits and four SUR1 regulatory subunits: Kir6.2 mediates channel inhibition by ATP, whereas the potentiatory action of MgADP involves the nucleotide-binding domains (NBDs) of SUR1. We show here that MgATP (like MgADP) is able to stimulate KATP channel activity, but that this effect normally is masked by the potent inhibitory effect of the nucleotide. Mg2+ caused an apparent reduction in the inhibitory action of ATP on wild-type KATP channels, and MgATP actually activated KATP channels containing a mutation in the Kir6.2 subunit that impairs nucleotide inhibition (R50G). Both of these effects were abolished when mutations were made in the NBDs of SUR1 that are predicted to abolish MgATP binding and/or hydrolysis (D853N, D1505N, K719A, or K1384M). These results suggest that, like MgADP, MgATP stimulates KATP channel activity by interaction with the NBDs of SUR1. Further support for this idea is that the ATP sensitivity of a truncated form of Kir6.2, which shows functional expression in the absence of SUR1, is unaffected by Mg2+.
Resumo:
Elevated levels of the p21WAF1 (p21) cyclin-dependent kinase inhibitor induce growth arrest. We have characterized a panel of monoclonal antibodies against human p21 in an effort to understand the dynamic regulatory interactions between this and other cellular proteins during the cell cycle. The use of these reagents has allowed us to address several important, yet unresolved, issues concerning the biological activity of p21, including the potential kinase activity of complexes that associate with this cyclin-dependent kinase inhibitor. We have found that the kinase activity of cyclin A/Cdk2 associated with p21 is significantly lower than that of cyclin A/Cdk2 free of p21, suggesting that p21 abolishes its activity in vivo, and the use of multiple antibodies has enabled us to begin the study of the molecular architecture of p21 complexes in vivo. In addition, we found that human fibroblasts released from a quiescent state display abundant amounts of p21 devoid of associated proteins (“free” p21), the levels of which decrease as cells approach S phase. Cyclin A levels increase as the amount of monomeric p21 decreases, resulting in an excess of cyclin A/Cdk2 complexes that are not bound to, or inactivated by, p21. Our data strengthen the notion that the G1-to-S phase transition in human fibroblasts occurs when the concentration of cyclin A/Cdk2 surpasses that of p21.
Resumo:
By using antisense RNA, Lck-deficient transfectants of a T helper 2 (Th2) clone have been derived and shown to have a qualitative defect in the T cell receptor signaling pathway. A striking feature observed only in Lck-deficient T cells was the presence of a constitutively tyrosine-phosphorylated 32-kDa protein. In the present study, we provide evidence that this aberrantly hyperphosphorylated protein is p34cdc2 (cdc2) a key regulator of cell-cycle progression. Lck-deficient transfectants expressed high levels of cdc2 protein and its regulatory units, cyclins A and B. The majority of cdc2, however, was tyrosine-phosphorylated and therefore enzymatically inactive. The transfectants were significantly larger than the parental cells and contained 4N DNA. These results establish that a deficiency in Lck leads to a cell-cycle arrest in G2. Moreover, transfected cells were hypersusceptible to apoptosis when activated through the T cell receptor. Importantly, however, this hypersusceptibility was largely reversed in the presence of T cell growth factors. These findings provide evidence that, in mature T lymphocytes, cell-cycle progression through the G2–M check point requires expression of the Src-family protein tyrosine kinase, Lck. This requirement is Lck-specific; it is observed under conditions in which the closely related Fyn kinase is expressed normally, evincing against a redundancy of function between these two kinases.
Resumo:
A protease-resistant core domain of the neuronal SNARE complex consists of an α-helical bundle similar to the proposed fusogenic core of viral fusion proteins [Skehel, J. J. & Wiley, D. C. (1998) Cell 95, 871–874]. We find that the isolated core of a SNARE complex efficiently fuses artificial bilayers and does so faster than full length SNAREs. Unexpectedly, a dramatic increase in speed results from removal of the N-terminal domain of the t-SNARE syntaxin, which does not affect the rate of assembly of v-t SNARES. In the absence of this negative regulatory domain, the half-time for fusion of an entire population of lipid vesicles by isolated SNARE cores (≈10 min) is compatible with the kinetics of fusion in many cell types.
Resumo:
Experimental autoimmune encephalomyelitis (EAE) induced with myelin proteolipid protein (PLP) residues 139–151 (HSLGKWLGHPDKF) can be prevented by treatment with a T cell receptor (TCR) antagonist peptide (L144/R147) generated by substituting at the two principal TCR contact residues in the encephalitogenic peptide. The TCR antagonist peptide blocks activation of encephalitogenic Th1 helper cells in vitro, but the mechanisms by which the antagonist peptide blocks EAE in vivo are not clear. Immunization with L144/R147 did not inhibit generation of PLP-(139–151)-specific T cells in vivo. Furthermore, preimmunization with L144/R147 protected mice from EAE induced with the encephalitogenic peptides PLP-(178–191) and myelin oligodendrocyte protein (MOG) residues 92–106 and with mouse myelin basic protein (MBP). These data suggest that the L144/R147 peptide does not act as an antagonist in vivo but mediates bystander suppression, probably by the generation of regulatory T cells. To confirm this we generated T cell lines and clones from animals immunized with PLP-(139–151) plus L144/R147. T cells specific for L144/R147 peptide were crossreactive with the native PLP-(139–151) peptide, produced Th2/Th0 cytokines, and suppressed EAE upon adoptive transfer. These studies demonstrate that TCR antagonist peptides may have multiple biological effects in vivo. One of the principal mechanisms by which these peptides inhibit autoimmunity is by the induction of regulatory T cells, leading to bystander suppression of EAE. These results have important implications for the treatment of autoimmune diseases where there are autopathogenic responses to multiple antigens in the target organ.
Resumo:
We have used the interaction between the erythroid-specific enhancer in hypersensitivity site 2 of the human β-globin locus control region and the globin gene promoters as a paradigm to examine the mechanisms governing promoter/enhancer interactions in this locus. We have demonstrated that enhancer-dependent activation of the globin promoters is dependent on the presence of both a TATA box in the proximal promoter and the binding site for the erythroid-specific heteromeric transcription factor NF-E2 in the enhancer. Mutational analysis of the transcriptionally active component of NF-E2, p45NF-E2, localizes the critical region for this function to a proline-rich transcriptional activation domain in the NH2-terminal 80 amino acids of the protein. In contrast to the wild-type protein, expression of p45 NF-E2 lacking this activation domain in an NF-E2 null cell line fails to support enhancer-dependent transcription in transient assays. More significantly, the mutated protein also fails to reactivate expression of the endogenous β- or α-globin loci in this cell line. Protein-protein interaction studies reveal that this domain of p45 NF-E2 binds specifically to a component of the transcription initiation complex, TATA binding protein associated factor TAFII130. These findings suggest one potential mechanism for direct recruitment of distal regulatory regions of the globin loci to the individual promoters.
Resumo:
The partially overlapping ORF P and ORF O are located within the domains of the herpes simplex virus 1 genome transcribed during latency. Earlier studies have shown that ORF P is repressed by infected cell protein 4 (ICP4), the major viral regulatory protein, binding to its cognate site at the transcription initiation site of ORF P. The ORF P protein binds to p32, a component of the ASF/SF2 alternate splicing factors; in cells infected with a recombinant virus in which ORF P was derepressed there was a significant decrease in the expression of products of key regulatory genes containing introns. We report that (i) the expression of ORF O is repressed during productive infection by the same mechanism as that determining the expression of ORF P; (ii) in cells infected at the nonpermissive temperature for ICP4, ORF O protein is made in significantly lower amounts than the ORF P protein; (iii) the results of insertion of a sequence encoding 20 amino acids between the putative initiator methionine codons of ORF O and ORF P suggest that ORF O initiates at the methionine codon of ORF P and that the synthesis of ORF O results from frameshift or editing of its RNA; and (iv) glutathione S-transferase–ORF O fusion protein bound specifically ICP4 and precluded its binding to its cognate site on DNA in vitro. These and earlier results indicate that ORF P and ORF O together have the capacity to reduce the synthesis or block the expression of regulatory proteins essential for viral replication in productive infection.
Resumo:
The current studies explore the mechanism by which the sphingomyelin content of mammalian cells regulates transcription of genes encoding enzymes of cholesterol synthesis. Previous studies by others have shown that depletion of sphingomyelin by treatment with neutral sphingomyelinase causes a fraction of cellular cholesterol to translocate from the plasma membrane to the endoplasmic reticulum where it expands a regulatory pool that leads to down-regulation of cholesterol synthesis and up-regulation of cholesterol esterification. Here we show that sphingomyelinase treatment of cultured Chinese hamster ovary cells prevents the nuclear entry of sterol regulatory element binding protein-2 (SREBP-2), a membrane-bound transcription factor required for transcription of several genes involved in the biosynthesis and uptake of cholesterol. Nuclear entry is blocked because sphingomyelinase treatment inhibits the proteolytic cleavage of SREBP-2 at site 1, thereby preventing release of the active NH2-terminal fragments from cell membranes. Sphingomyelinase treatment thus mimics the inhibitory effect on SREBP processing that occurs when exogenous sterols are added to cells. Sphingomyelinase treatment did not block site 1 proteolysis of SREBP-2 in 25-RA cells, a line of Chinese hamster ovary cells that is resistant to the suppressive effects of sterols, owing to an activating point mutation in the gene encoding SREBP cleavage-activating protein. In 25-RA cells, sphingomyelinase treatment also failed to down-regulate the mRNA for 3-hydroxy-3-methylglutaryl CoA synthase, a cholesterol biosynthetic enzyme whose transcription depends on the cleavage of SREBPs. Considered together with previous data, the current results indicate that cells regulate the balance between cholesterol and sphingomyelin content by regulating the proteolytic cleavage of SREBPs.
Resumo:
Recently, TAP42 was isolated as a high copy suppressor of sit4−, a yeast phosphatase related to protein phosphatase 2A (PP2A). TAP42 is related to the murine α4 protein, which was discovered independently by its association with Ig-α in the B cell receptor complex. Herein we show that a glutathione S-transferase (GST)–α4 fusion protein bound the catalytic subunit (C) of human PP2A from monomeric or multimeric preparations of PP2A in a “pull-down” assay. In an overlay assay, the GST–α4 protein bound to the phosphorylated and unphosphorylated forms of C that were separated in two-dimensional gels and immobilized on filters. The results show direct and exclusive binding of α4 to C. This is unusual because all known regulatory B subunits, or tumor virus antigens, bind stably only to the AC dimer of PP2A. The α4–C form of PP2A had an increased activity ratio compared with the AC form of PP2A when myelin basic protein phosphorylated by mitogen-activated protein kinase and phosphorylase a were used as substrates. Recombinant α4 cleaved from GST was phosphorylated by p56lck tyrosine kinase and protein kinase C. A FLAG-tagged α4 expressed in COS7 cells was recovered as a protein containing phosphoserine and coimmunoprecipitated with the C but not the A subunit of PP2A. Treatment of cells with rapamycin prevented the association of PP2A with FLAG-α4. The results reveal a novel heterodimer α4–C form of PP2A that may be involved in rapamycin-sensitive signaling pathways in mammalian cells.
Resumo:
Caveolae form the terminus for a major pathway of intracellular free cholesterol (FC) transport. Caveolin mRNA levels in confluent human skin fibroblasts were up-regulated following increased uptake of low density lipoprotein (LDL) FC. The increase induced by FC was not associated with detectable change in mRNA stability, indicating that caveolin mRNA levels were mediated at the level of gene transcription. A total of 924 bp of 5′ flanking region of the caveolin gene were cloned and sequenced. The promoter sequence included three G+C-rich potential sterol regulatory elements (SREs), a CAAT sequence and a Sp1 consensus sequence. Deletional mutagenesis of individual SRE-like sequences indicated that of these two (at −646 and −395 bp) were essential for the increased transcription rates mediated by LDL-FC, whereas the third was inconsequential. Gel shift analysis of protein binding from nuclear extracts to these caveolin promoter DNA sequences, together with DNase I footprinting, confirmed nucleoprotein binding to the SRE-like elements as part of the transcriptional response to LDL-FC. A supershift obtained with antibody to SRE-binding protein 1 (SPEBP-1) indicated that this protein binds at −395 bp. There was no reaction at −395 bp with anti-Sp1 antibody nor with either antibody at −646 bp. The cysteine protease inhibitor N-acetyl-leu-leu-norleucinal (ALLN), which inhibits SREBP catabolism, superinhibited caveolin mRNA levels regardless of LDL-FC. This finding suggests that SREBP inhibits caveolin gene transcription in contrast to its stimulating effect on other promoters. The findings of this study are consistent with the postulated role for caveolin as a regulator of cellular FC homeostasis in quiescent peripheral cells, and the coordinate regulation by SREBP of FC influx and efflux.