30 resultados para core human needs


Relevância:

30.00% 30.00%

Publicador:

Resumo:

A human melanoma-associated chondroitin sulfate proteoglycan (MCSP), recognized by mAb 9.2.27, plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. We report here the molecular cloning and nucleotide sequencing of cDNA encoding the entire core protein of human MCSP and provide its deduced amino acid sequence. This core protein contains an open reading frame of 2322 aa, encompassing a large extracellular domain, a hydrophobic transmembrane region, and a relatively short cytoplasmic tail. Northern blot analysis indicated that MCSP cDNA probes detect a single 8.0-kb RNA species expressed in human melanoma cell lines. In situ hybridization experiments with a segment of the MCSP coding sequence localized MCSP mRNA in biopsies prepared from melanoma skin metastases. Multiple human Northern blots with an MCSP-specific probe revealed a strong hybridization signal only with melanoma cells and not with other human cancer cells or a variety of human fetal and adult tissues. These data indicate that MCSP represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. The availability of cDNAs encoding MCSP should facilitate studies designed to establish correlations between structure and function of this molecule and help to establish its role in the progression of human malignant melanoma.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The in vivo effectiveness of ribozymes strongly depends on the correct choice of the vector molecule. High levels of expression, stability, active conformation, and correct cellular localization are the most important features for a ribozyme vector. We have exploited the utilization of the U1 small nuclear RNA (snRNA) as a vector for specifically targeting a ribozyme into the nucleus. The Rev pre-mRNA of human immunodeficiency virus type 1 was chosen as target for testing the activity of the Ul-ribozyme. The catalytic core of the hammerhead motif, plus the recognition sequences, substituted the stem-loop III of the U1 snRNA. The resulting construct displays efficient cleavage activity in vitro. In addition, in the in vivo system of Xenopus laevis oocytes, the Ul-chimeric ribozyme accumulates in large amounts in the nucleus and produces a considerable reduction of Rev pre-mRNA levels. The Rev-specific ribozyme was also inserted in a derivative of the Ul snRNA mutated in the region of pairing with the 5' splice site, such as to match it with the suboptimal splice junction of the Rev precursor. This construct shows more efficient reduction of Rev pre-mRNA in vivo than the wild-type U1 vector.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transcription factor IIH (TFIIH) is a multisubunit complex required for transcription and for DNA nucleotide excision repair. TFIIH possesses three enzymatic activities: (i) an ATP-dependent DNA helicase, (ii) a DNA-dependent ATPase, and (iii) a kinase with specificity for the carboxyl-terminal domain of RNA polymerase II. The kinase activity was recently identified as the cdk (cyclin-dependent kinase) activating kinase, CAK, composed of cdk7, cyclin H, and MAT-1. Here we report the isolation and characterization of three distinct CAK-containing complexes from HeLa nuclear extracts: CAK, a novel CAK-ERCC2 complex, and TFIIH. CAK-ERCC2 can efficiently associate with core-TFIIH to reconstitute holo-TFIIH transcription activity. We present evidence proposing a critical role for ERCC2 in mediating the association of CAK with core TFIIH subunits.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Replication factor C (RFC, also called Activator I) is part of the processive eukaryotic DNA polymerase holoenzymes. The processive elongation of DNA chains requires that DNA polymerases are tethered to template DNA at primer ends. In eukaryotes the ring-shaped homotrimeric protein, proliferating cell nuclear antigen (PCNA), ensures tight template-polymerase interaction by encircling the DNA strand. Proliferating cell nuclear antigen is loaded onto DNA through the action of RFC in an ATP-dependent reaction. Human RFC is a protein complex consisting of five distinct subunits that migrate through SDS/polyacrylamide gels as protein bands of 140, 40, 38, 37, and 36 kDa. All five genes encoding the RFC subunits have been cloned and sequenced. A functionally identical RFC complex has been isolated from Saccharomyces cerevisiae and the deduced amino acid sequences among the corresponding human and yeast subunits are homologous. Here we report the expression of the five cloned human genes using an in vitro coupled transcription/translation system and show that the gene products form a complex resembling native RFC that is active in supporting an RFC-dependent replication reaction. Studies on the interactions between the five subunits suggest a cooperative mechanism in the assembly of the RFC complex. A three-subunit core complex, consisting of p36, p37, and p40, was identified and evidence is presented that p38 is essential for the interaction between this core complex and the large p140 subunit.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have isolated a cDNA encoding human ceramide glucosyltransferase (glucosylceramide synthase, UDP-glucose:N-acylsphingosine D-glucosyltransferase, EC 2.4.1.80) by expression cloning using as a recipient GM-95 cells lacking the enzyme. The enzyme catalyzes the first glycosylation step of glycosphingolipid synthesis and the product, glucosylceramide, serves as the core of more than 300 glycosphingolipids. The cDNA has a G+C-rich 5' untranslated region of 290 nucleotides and the open reading frame encodes 394 amino acids (44.9 kDa). A hydrophobic segment was found near the N terminus that is the potential signal-anchor sequence. In addition, considerable hydrophobicity was detected in the regions close to the C terminus, which may interact with the membrane. A catalytically active enzyme was produced from Escherichia coli transfected with the cDNA. Northern blot analysis revealed a single transcript of 3.5 kb, and the mRNA was widely expressed in organs. The amino acid sequence of ceramide glucosyltransferase shows no significant homology to ceramide galactosyltransferase, which indicates different evolutionary origins of these enzymes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The TATA box-binding protein (TBP) is required by all three eukaryotic RNA polymerases for correct initiation of transcription of ribosomal, messenger, small nuclear, and transfer RNAs. The cocrystal structure of the C-terminal/core region of human TBP complexed with the TATA element of the adenovirus major late promoter has been determined at 1.9 angstroms resolution. Structural and functional analyses of the protein-DNA complex are presented, with a detailed comparison to our 1.9-angstroms resolution structure of Arabidopsis thaliana TBP2 bound to the same TATA box.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Promoter and silencer elements of the immediate 5' flanking region of the gene coding for human factor VII were identified and characterized. The major transcription start site, designated as +1, was determined by RACE (rapid amplification of cDNA ends) analysis of human liver cDNA and was found to be located 50 bp upstream from the translation start site. Two minor transcription start sites were found at bp +32 bp and +37. Progressive deletions of the 5' flanking region were fused to the chloramphenicol acetyltransferase reporter gene and transient expression in HepG2 and HeLa cells was measured. Two promoter elements that were essential for hepatocyte-specific transcription were identified. The first site, FVIIP1, located at bp -19 to +1, functioned independently of orientation or position and contributed about one-third of the promoter activity of the factor VII gene. Electrophoretic mobility-shift, competition, and anti-hepatocyte nuclear factor 4 (HNF4) antibody supershift experiments demonstrated that this site contained an HNF-4 binding element homologous to the promoters in the genes coding for factor IX and factor X. The second site, FVIIP2, located at bp -50 to -26, also functioned independent of orientation or position and contributed about two thirds of the promoter activity in the gene for factor VII. Functional assays with mutant sequences demonstrated that a 10-bp G + C-rich core sequence which shares 90% sequence identity with the prothrombin gene enhancer was essential for the function of the second site. Mobility-shift and competition assays suggested that this site also binds hepatic-specific factors as well as the transcription factor Sp1. Two silencer elements located upstream of the promoter region spanning bp -130 to -103 (FVIIS1 site) and bp -202 to -130 (FVIIS2) were also identified by reporter gene assays.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Integration of human immunodeficiency virus (HIV) DNA into the human genome requires the virus-encoded integrase (IN) protein, and therefore the IN protein is a suitable target for antiviral strategies. To find a potent HIV IN inhibitor, we screened a "synthetic peptide combinatorial library." We identified a hexapeptide with the sequence HCKFWW that inhibits IN-mediated 3'-processing and integration with an IC50 of 2 microM. The peptide is active on IN proteins from other retroviruses such as HIV-2, feline immunodeficiency virus, and Moloney murine leukemia virus, supporting the notion that a conserved region of IN is targeted. The hexapeptide was also tested in the disintegration reaction. This phosphoryl-transfer reaction can be carried out by the catalytic core of IN alone, and the peptide HCKFWW was found to inhibit this reaction, suggesting that the hexapeptide acts at or near the catalytic site of IN. Identification of an IN hexapeptide inhibitor provides proof of concept for the approach, and, moreover, this peptide may be useful for structure-function analysis of IN.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Using the yeast two-hybrid system we have identified a human protein, GAIP (G Alpha Interacting Protein), that specifically interacts with the heterotrimeric GTP-binding protein G alpha i3. Interaction was verified by specific binding of in vitro-translated G alpha i3 with a GAIP-glutathione S-transferase fusion protein. GAIP is a small protein (217 amino acids, 24 kDa) that contains two potential phosphorylation sites for protein kinase C and seven for casein kinase 2. GAIP shows high homology to two previously identified human proteins, GOS8 and 1R20, two Caenorhabditis elegans proteins, CO5B5.7 and C29H12.3, and the FLBA gene product in Aspergillus nidulans--all of unknown function. Significant homology was also found to the SST2 gene product in Saccharomyces cerevisiae that is known to interact with a yeast G alpha subunit (Gpa1). A highly conserved core domain of 125 amino acids characterizes this family of proteins. Analysis of deletion mutants demonstrated that the core domain is the site of GAIP's interaction with G alpha i3. GAIP is likely to be an early inducible phosphoprotein, as its cDNA contains the TTTTGT sequence characteristic of early response genes in its 3'-untranslated region. By Northern analysis GAIP's 1.6-kb mRNA is most abundant in lung, heart, placenta, and liver and is very low in brain, skeletal muscle, pancreas, and kidney. GAIP appears to interact exclusively with G alpha i3, as it did not interact with G alpha i2 and G alpha q. The fact that GAIP and Sst2 interact with G alpha subunits and share a common domain suggests that other members of the GAIP family also interact with G alpha subunits through the 125-amino-acid core domain.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper describes a range of opportunities for military and government applications of human-machine communication by voice, based on visits and contacts with numerous user organizations in the United States. The applications include some that appear to be feasible by careful integration of current state-of-the-art technology and others that will require a varying mix of advances in speech technology and in integration of the technology into applications environments. Applications that are described include (1) speech recognition and synthesis for mobile command and control; (2) speech processing for a portable multifunction soldier's computer; (3) speech- and language-based technology for naval combat team tactical training; (4) speech technology for command and control on a carrier flight deck; (5) control of auxiliary systems, and alert and warning generation, in fighter aircraft and helicopters; and (6) voice check-in, report entry, and communication for law enforcement agents or special forces. A phased approach for transfer of the technology into applications is advocated, where integration of applications systems is pursued in parallel with advanced research to meet future needs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human transcription initiation factor TFIID is composed of the TATA-binding polypeptide (TBP) and at least 13 TBP-associated factors (TAFs) that collectively or individually are involved in activator-dependent transcription. To investigate protein-protein interactions involved in TFIID assembly and in TAF-mediated activator functions, we have cloned and expressed cDNAs encoding human TAFII80 and TAFII31. Coimmunoprecipitation assays showed that TAFII80 interacted with TAFII250, TAFII31, TAFII20, and TBP, but not with TAFII55. Similar assays showed that TAFII80 interacted with TFIIE alpha and with TFIIF alpha (RAP74) but not with TFIIB, TFIIE beta, or TFIIF beta (RAP30). Further studies with TAFII80 mutations revealed three distinct interaction domains which fall within regions conserved in human TAFII80, Drosophila TAFII60, and yeast TAFII60. The N terminus of TAFII80 (residues 1-100) interacts with both TAFII31 and TAFII20, while two C-terminal regions are involved, respectively, in interactions with TAFII250 and TFIIF alpha (RAP74) (residues 203-276) and with TBP and TFIIE alpha (residues 377-505). The interactions between TAFII80 and general factors TFIIE alpha and TFIIF alpha (RAP74) could be important for recruitment of GTFs during activator-dependent transcription. Because TAFs 80, 31, and 20 show sequence similarities to histones H4, H3, and H2B, as well as some parallel interactions, this subset of TAFs may form a related core structure within TFIID.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Retrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and sickle cell anemia), however, has been hampered by the inability to generate recombinant viruses able to efficiently and faithfully transmit the necessary sequences for appropriate gene expression. We have addressed this problem by carefully examining the interactions between retroviral and beta-globin gene sequences which affect vector transmission, stability, and expression. First, we examined the transmission properties of a large number of different recombinant proviral genomes which vary both in the precise nature of vector, beta-globin structural gene, and locus control region (LCR) core sequences incorporated and in the placement and orientation of those sequences. Through this analysis, we identified one specific vector, termed M beta 6L, which carries both the human beta-globin gene and core elements HS2, HS3, and HS4 from the LCR and faithfully transmits recombinant proviral sequences to cells with titers greater than 10(6) per ml. Populations of murine erythroleukemia (MEL) cells transduced by this virus expressed levels of human beta-globin transcript which, on a per gene copy basis, were 78% of the levels detected in an MEL-derived cell line, Hu11, which carries human chromosome 11, the site of the beta-globin locus. Analysis of individual transduced MEL cell clones, however, indicated that, while expression was detected in every clone tested (n = 17), the levels of human beta-globin treatment varied between 4% and 146% of the levels in Hu11. This clonal variation in expression levels suggests that small beta-globin LCR sequences may not provide for as strict chromosomal position-independent expression of beta-globin as previously suspected, at least in the context of retrovirus-mediated gene transfer.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The integrase protein of human immunodeficiency virus type 1 is necessary for the stable integration of the viral genome into host DNA. Integrase catalyzes the 3' processing of the linear viral DNA and the subsequent DNA strand transfer reaction that inserts the viral DNA ends into host DNA. Although full-length integrase is required for 3' processing and DNA strand transfer activities in vitro, the central core domain of integrase is sufficient to catalyze an apparent reversal of the DNA strand transfer reaction, termed disintegration. This catalytic core domain, as well as the full-length integrase, has been refractory to structural studies by x-ray crystallography or NMR because of its low solubility and propensity to aggregate. In an attempt to improve protein solubility, we used site-directed mutagenesis to replace hydrophobic residues within the core domain with either alanine or lysine. The single substitution of lysine for phenylalanine at position 185 resulted in a core domain that was highly soluble, monodisperse in solution, and retained catalytic activity. This amino acid change has enabled the catalytic domain of integrase to be crystallized and the structure has been solved to 2.5-A resolution [Dyda, F., Hickman, A. B., Jenkins, T. M., Engelman, A., Craigie, R. & Davies, D. R. (1994) Science 266, 1981-1986]. Systematic replacement of hydrophobic residues may be a useful strategy to improve the solubility of other proteins to facilitate structural and biochemical studies.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We report characterization of a human T-cell lymphotropic virus type II (HTLV-II) isolated from an interleukin 2-dependent CD8 T-cell line derived from peripheral blood mononuclear cells of a healthy, HTLV-II-seropositive female Bakola Pygmy, aged 59, living in a remote equatorial forest area in south Cameroon. This HTLLV-II isolate, designated PYGCAM-1, reacted in an indirect immunofluorescence assay with HTLV-II and HTLV-I polyclonal antibodies and with an HTLV-I/II gp46 monoclonal antibody but not with HTLV-I gag p19 or p24 monoclonal antibodies. The cell line produced HTLV-I/II p24 core antigen and retroviral particles. The entire env gene (1462 bp) and most of the long terminal repeat (715 bp) of the PYGCAM-1 provirus were amplified by the polymerase chain reaction using HTLV-II-specific primers. Comparison with the long terminal repeat and envelope sequences of prototype HTLV-II strains indicated that PYGCAM-1 belongs to the subtype B group, as it has only 0.5-2% nucleotide divergence from HTLV-II B strains. The finding of antibodies to HTLV-II in sera taken from the father of the woman in 1984 and from three unrelated members of the same population strongly suggests that PYGCAM-1 is a genuine HTLV-II that has been present in this isolated population for a long time. The low genetic divergence of this African isolate from American isolates raises questions about the genetic variability over time and the origin and dissemination of HTLV-II, hitherto considered to be predominantly a New World virus.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.