Unsaturated fatty acids inhibit transcription of the sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing ligand-dependent activation of the LXR

Sterol regulatory element-binding protein-1c (SREBP-1c) enhances transcription of genes encoding enzymes of unsaturated fatty acid biosynthesis in liver. SREBP-1c mRNA is known to increase when cells are treated with agonists of liver X receptor (LXR), a nuclear hormone receptor, and to decrease when cells are treated with unsaturated fatty acids, the end products of SREBP-1c action. Here we show that unsaturated fatty acids lower SREBP-1c mRNA levels in part by antagonizing the actions of LXR. In cultured rat hepatoma cells, arachidonic acid and other fatty acids competitively inhibited activation of the endogenous SREBP-1c gene by an LXR ligand. Arachidonate also blocked the activation of a synthetic LXR-dependent promoter in transfected human embryonic kidney-293 cells. In vitro, arachidonate and other unsaturated fatty acids competitively blocked activation of LXR, as reflected by a fluorescence polarization assay that measures ligand-dependent binding of LXR to a peptide derived from a coactivator. These data offer a potential mechanism that partially explains the long-known ability of dietary unsaturated fatty acids to decrease the synthesis and secretion of fatty acids and triglycerides in livers of humans and other animals.

Activation of the JC virus Tat-responsive transcriptional control element by association of the Tat protein of human immunodeficiency virus 1 with cellular protein Purα

JC virus is activated to replicate in glial cells of many AIDS patients with neurological disorders. In human glial cells, the human immunodeficiency virus 1 (HIV-1) Tat protein activates the major late promoter of JC virus through a Tat-responsive DNA element, termed upTAR, which is a recognition site for cellular Purα, a sequence-specific single-stranded DNA binding protein implicated in cell cycle control of DNA replication and transcription. Tat interacts with two leucine-rich repeats in Purα to form a complex that can be immunoprecipitated from cell extracts. Tat enhances the ability of purified glutathione S-transferase-Purα (GST-Purα) to bind the upTAR element. Tat acts synergistically with Purα, in a cell-cycle-dependent manner, to activate transcription at an upTAR element placed upstream of a heterologous promoter. Since Purα is ubiquitously expressed in human cells and since PUR elements are located near many promoters and origins of replication, the Tat-Purα interaction may be implicated in effects of HIV-1 throughout the full range of HIV-1-infected cells.

Purification and cDNA cloning of a second apoptosis-related cysteine protease that cleaves and activates sterol regulatory element binding proteins.

We have purified from hamster liver a second cysteine protease that cleaves and activates sterol regulatory element binding proteins (SREBPs). cDNA cloning revealed that this enzyme is the hamster equivalent of Mch3, a human enzyme that is related to the interleukin 1beta converting enzyme. We call this enzyme Mch3/SCA-2. It is 54% identical to hamster CPP32/SCA-1, a cysteine protease that was earlier shown to cleave SREBPs at a conserved Asp between the basic helix-loop-helix leucine zipper domain and the membrane attachment domain. This cleavage liberates an NH2-terminal fragment of approximately 460 amino acids that activates transcription of genes encoding the low density lipoprotein receptor and enzymes of cholesterol synthesis. Mch3/SCA-2 and CPP32/SCA-I are synthesized as inactive 30-35 kDa precursors that are thought to be cleaved during apoptosis to generate active fragments of approximately 20 and approximately 10 kDa. The current data lend further support to the notion that SREBPs are cleaved and activated as part of the program in programmed cell death.

A long-range regulatory element of Hoxc8 identified by using the pClasper vector.

Hox genes are located in highly conserved clusters. The significance of this organization is unclear, but one possibility is that regulatory regions for individual genes are dispersed throughout the cluster and shared with other Hox genes. This hypothesis is supported by studies on several Hox genes in which even large genomic regions immediately surrounding the gene fail to direct the complete expression pattern in transgenic mice. In particular, previous studies have identified proximal regulatory regions that are primarily responsible for early phases of mouse Hoxc8 expression. To locate additional regulatory regions governing expression during the later periods of development, a yeast homologous recombination-based strategy utilizing the pClasper vector was employed. Using homologous recombination into pClasper, we cloned a 27-kb region around the Hoxc8 gene from a yeast artificial chromosome. A reporter gene was introduced into the coding region of the isolated gene by homologous recombination in yeast. This large fragment recapitulates critical aspects of Hoxc8 expression in transgenic mice. We show that the regulatory elements that maintain the anterior boundaries of expression in the neural tube and paraxial mesoderm are located between 11 and 19 kb downstream of the gene.

Sterol regulatory element binding protein binds to a cis element in the promoter of the farnesyl diphosphate synthase gene.

Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.

Domains with transcriptional regulatory activity within the ALL1 and AF4 proteins involved in acute leukemia.

The ALLI gene, located at chromosome band 11q23, is involved in acute leukemia through a series of chromosome translocations and fusion to a variety of genes, most frequently to A4 and AF9. The fused genes encode chimeric proteins proteins. Because the Drosophila homologue of ALL1, trithorax, is a positive regulator of homeotic genes and acts at the level of transcription, it is conceivable that alterations in ALL1 transcriptional activity may underlie its action in malignant transformation. To begin studying this, we examined the All1, AF4, AF9, and AF17 proteins for the presence of potential transcriptional regulatory domains. This was done by fusing regions of the proteins to the yeast GAL4 DNA binding domain and assaying their effect on transcription of a reporter gene. A domain of 55 residues positioned at amino acids 2829-2883 of ALL1 was identified as a very strong activator. Further analysis of this domain by in vitro mutagenesis pointed to a core of hydrophobic and acidic residues as critical for the activity. An ALL1 domain that repressed transcription of the reporter gene coincided with the sequence homologous to a segment of DNA methyltransferase. An AF4 polypeptide containing residues 480-560 showed strong activation potential. The C-terminal segment of AF9 spanning amino acids 478-568 transactivated transcription of the reporter gene in HeLa but not in NIH 3T3 cells. These results suggest that ALL1, AF4, and probably AF9 interact with the transcriptional machinery of the cell.

Conservation and function of the transcriptional regulatory protein Runt.

A phylogenetic approach was used to identify conserved regions of the transcriptional regulator Runt. Alignment of the deduced protein sequences from Drosophila melanogaster, Drosophila pseudoobscura, and Drosophila virilis revealed eight blocks of high sequence homology separated by regions with little or no homology. The largest conserved block contains the Runt domain, a DNA and protein binding domain conserved in a small family of mammalian transcription factors. The functional properties of the Runt domain from the D. melanogaster gene and the human AML1 (acute myeloid leukemia 1) gene were compared in vitro and in vivo. Electrophoretic mobility-shift assays with Runt/AML1 chimeras demonstrated that the different DNA binding properties of Runt and AML1 are due to differences within their respective Runt domains. Ectopic expression experiments indicated that proteins containing the AML1 Runt domain function in Drosophila embryos and that sequences outside of this domain are important in vivo.

Gut-specific transcriptional regulatory elements of the carboxypeptidase gene are conserved between black flies and Drosophila.

Millions of people die every year in the tropical world from diseases transmitted by hematophagous insects. Failure of conventional containment measures emphasizes the need for additional approaches, such as transformation of vector insects with genes that restrict vectorial capacity. The availability of an efficient promoter to drive foreign genes in transgenic insects is a necessary tool to test the feasibility of such approach. Here we characterize the putative promoter region of a black fly midgut carboxypeptidase gene and show that these sequences correctly direct the expression of a beta-glucuronidase reporter in Drosophila melanogaster. By histochemical staining and mRNA analysis, we found that the gene is expressed strongly and gut-specifically in the transgenic Drosophila. This gut-specific black fly carboxypeptidase promoter provides a valuable tool for the study of disease vectors.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Host factors LR1 and Sp1 regulate the Fp promoter of Epstein-Barr virus.

The Epstein-Barr virus EBNA-1 gene product is essential for latent replication of the virus. In transformed cells characterized by the most restricted patterns of viral latent gene expression, EBNA-1 transcription is driven from the Fp promoter. We have used genetic and biochemical techniques to study the promoter-proximal elements that regulate Fp expression in B cells. We show that a 114-bp fragment of DNA spanning the Fp "TATA" box functions as a remarkably active transcriptional regulatory element in B cells. Two host factors, Sp1 and LR1, regulate Fp transcription from the promoter-proximal region. Sp1 binds a single site just downstream of the TATA box, and LR1 binds two sites just upstream of the TATA box. Transcripts from both the viral genome and the minimal promoter initiate at the same unique site, and one function of LR1 at Fp is to direct initiation to this unique start site. In contrast to Sp1, which is ubiquitous, LR1 is present only in activated B cells and may contribute to cell-type-specific transformation by Epstein-Barr virus.

Delineation of a slow-twitch-myofiber-specific transcriptional element by using in vivo somatic gene transfer.

Contractile proteins are encoded by multigene families, most of whose members are differentially expressed in fast- versus slow-twitch myofibers. This fiber-type-specific gene regulation occurs by unknown mechanisms and does not occur within cultured myocytes. We have developed a transient, whole-animal assay using somatic gene transfer to study this phenomenon and have identified a fiber-type-specific regulatory element within the promoter region of a slow myofiber-specific gene. A plasmid-borne luciferase reporter gene fused to various muscle-specific contractile gene promoters was differentially expressed when injected into slow- versus fast-twitch rat muscle: the luciferase gene was preferentially expressed in slow muscle when fused to a slow troponin I promoter, and conversely, was preferentially expressed in fast muscle when fused to a fast troponin C promoter. In contrast, the luciferase gene was equally well expressed by both muscle types when fused to a nonfiber-type-specific skeletal actin promoter. Deletion analysis of the troponin I promoter region revealed that a 157-bp enhancer conferred slow-muscle-preferential activity upon a minimal thymidine kinase promoter. Transgenic analysis confirmed the role of this enhancer in restricting gene expression to slow-twitch myofibers. Hence, somatic gene transfer may be used to rapidly define elements that direct myofiber-type-specific gene expression prior to the generation of transgenic mice.

A calcium responsive element that regulates expression of two calcium binding proteins in Purkinje cells

Calbindin D28 encodes a calcium binding protein that is expressed in the cerebellum exclusively in Purkinje cells. We have used biolistic transfection of organotypic slices of P12 cerebellum to identify a 40-bp element from the calbindin promoter that is necessary and sufficient for Purkinje cell specific expression in this transient in situ assay. This element (PCE1) is also present in the calmodulin II promoter, which regulates expression of a second Purkinje cell Ca2+ binding protein. Expression of high levels of exogenous calbindin or calretinin decreased transcription mediated by PCE1 in Purkinje cells 2.5- to 3-fold, whereas the presence of 1 μM ionomycin in the extracellular medium increased expression. These results demonstrate that PCE1 is a component of a cell-specific and Ca2+-sensitive transcriptional regulatory mechanism that may play a key role in setting the Ca2+ buffering capacity of Purkinje cells.

Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and their interactions with CBF1, a transcriptional activator involved in cold-regulated gene expression

The Arabidopsis CBF transcriptional activators bind to the CRT/DRE regulatory element present in the promoters of many cold-regulated genes and stimulate their transcription. Expression of the CBF1 proteins in yeast activates reporter genes carrying a minimal promoter with the CRT/DRE as an upstream regulatory element. Here we report that this ability of CBF1 is dependent upon the activities of three key components of the yeast Ada and SAGA complexes, namely the histone acetyltransferase (HAT) Gcn5 and the transcriptional adaptor proteins Ada2 and Ada3. This result suggested that CBF1 might function through the action of similar complexes in Arabidopsis. In support of this hypothesis we found that Arabidopsis has a homolog of the GCN5 gene and two homologs of ADA2, the first report of multiple ADA2 genes in an organism. The Arabidopsis GCN5 protein has intrinsic HAT activity and can physically interact in vitro with both the Arabidopsis ADA2a and ADA2b proteins. In addition, the CBF1 transcriptional activator can interact with the Arabidopsis GCN5 and ADA2 proteins. We conclude that Arabidopsis encodes HAT-containing adaptor complexes that are related to the Ada and SAGA complexes of yeast and propose that the CBF1 transcriptional activator functions through the action of one or more of these complexes.

Transcriptional activation of human adult alpha-globin genes by hypersensitive site-40 enhancer: function of nuclear factor-binding motifs occupied in erythroid cells.

The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element.

Structural flexibility in transcription complex formation revealed by protein–DNA photocrosslinking

The Oct-1 POU domain binds diverse DNA-sequence elements and forms a higher-order regulatory complex with the herpes simplex virus coregulator VP16. The POU domain contains two separate DNA-binding domains joined by a flexible linker. By protein–DNA photocrosslinking we show that the relative positioning of the two POU DNA-binding domains on DNA varies depending on the nature of the DNA target. On a single VP16-responsive element, the POU domain adopts multiple conformations. To determine the structure of the Oct-1 POU domain in a multiprotein complex with VP16, we allowed VP16 to interact with previously crosslinked POU-domain–DNA complexes and found that VP16 can associate with multiple POU-domain conformations. These results reveal the dynamic potential of a DNA-binding domain in directing transcriptional regulatory complex formation.