22 resultados para Nested
Resumo:
The DAN/TIR mannoprotein genes of Saccharomyces cerevisiae (DAN1, DAN2, DAN3, DAN4, TIR1, TIR2, TIR3 and TIR4) are expressed in anaerobic cells while the predominant cell wall proteins Cwp1 and Cwp2 are down-regulated. Elements involved in activation and repression of the DAN/TIR genes were defined in this study, using the DAN1 promoter as a model. Nested deletions in a DAN1/lacZ reporter pinpointed regions carrying activation and repression elements. Inspection revealed two consensus sequences subsequently shown to be independent anaerobic response elements (AR1, consensus TCGTTYAG; AR2, consensus AAAAATTGTTGA). AR1 is found in all of the DAN/TIR promoters; AR2 is found in DAN1, DAN2 and DAN3. A 120 bp segment carrying two copies of AR1 preferentially activated transcription of lacZ under anaerobic conditions. A fusion of three synthetic copies of AR1 to MEL1 was also expressed anaerobically. Mutations in either AR1 site within the 120 bp segment caused a drastic loss of expression, indicating that both are necessary for activation and implying cooperativity between adjacent transcriptional activation complexes. A single AR2 site carried on a 46 bp fragment from the DAN1 promoter activated lacZ transcription under anaerobic conditions, as did a 26 bp synthetic AR2 fragment fused to MEL1. Nucleotide substitutions within the AR2 sequence eliminated the activity of the 46 bp segment. Ablation of the AR2 sequences in the full promoter caused a partial reduction of expression. The presence of the ATTGTT core (recognized by HMG proteins) in the AR2 sequence suggests that an HMG protein may activate through AR2. One region was implicated in aerobic repression of DAN1. It contains sites for the heme-induced Mot3 and Rox1 repressors.
Resumo:
For the most part, studies of grass genome structure have been limited to the generation of whole-genome genetic maps or the fine structure and sequence analysis of single genes or gene clusters. We have investigated large contiguous segments of the genomes of maize, sorghum, and rice, primarily focusing on intergenic spaces. Our data indicate that much (>50%) of the maize genome is composed of interspersed repetitive DNAs, primarily nested retrotransposons that insert between genes. These retroelements are less abundant in smaller genome plants, including rice and sorghum. Although 5- to 200-kb blocks of methylated, presumably heterochromatic, retrotransposons flank most maize genes, rice and sorghum genes are often adjacent. Similar genes are commonly found in the same relative chromosomal locations and orientations in each of these three species, although there are numerous exceptions to this collinearity (i.e., rearrangements) that can be detected at the levels of both the recombinational map and cloned DNA. Evolutionarily conserved sequences are largely confined to genes and their regulatory elements. Our results indicate that a knowledge of grass genome structure will be a useful tool for gene discovery and isolation, but the general rules and biological significance of grass genome organization remain to be determined. Moreover, the nature and frequency of exceptions to the general patterns of grass genome structure and collinearity are still largely unknown and will require extensive further investigation.
Resumo:
We describe a method to screen pools of DNA from multiple transposon lines for insertions in many genes simultaneously. We use thermal asymmetric interlaced–PCR, a hemispecific PCR amplification protocol that combines nested, insertion-specific primers with degenerate primers, to amplify DNA flanking the transposons. In reconstruction experiments with previously characterized Arabidopsis lines carrying insertions of the maize Dissociation (Ds) transposon, we show that fluorescently labeled, transposon-flanking fragments overlapping ORFs hybridize to cognate expressed sequence tags (ESTs) on a DNA microarray. We further show that insertions can be detected in DNA pools from as many as 100 plants representing different transposon lines and that all of the tested, transposon-disrupted genes whose flanking fragments can be amplified individually also can be detected when amplified from the pool. The ability of a transposon-flanking fragment to hybridize declines rapidly with decreasing homology to the spotted DNA fragment, so that only ESTs with >90% homology to the transposon-disrupted gene exhibit significant cross-hybridization. Because thermal asymmetric interlaced–PCR fragments tend to be short, use of the present method favors recovery of insertions in and near genes. We apply the technique to screening pools of new Ds lines using cDNA microarrays containing ESTs for ≈1,000 stress-induced and -repressed Arabidopsis genes.
Resumo:
Fossorial salamanders typically have elongate and attenuated heads and bodies, diminutive limbs, hands and feet, and extremely elongate tails. Batrachoseps from California, Lineatriton from eastern México, and Oedipina from southern México to Ecuador, all members of the family Plethodontidae, tribe Bolitoglossini, resemble one another in external morphology, which has evolved independently. Whereas Oedipina and Batrachoseps are elongate because there are more trunk vertebrae, a widespread homoplasy (parallelism) in salamanders, the genus Lineatriton is unique in having evolved convergently by an alternate “giraffe-neck” developmental program. Lineatriton has the same number of trunk vertebrae as related, nonelongated taxa, but individual trunk vertebrae are elongated. A robust phylogenetic hypothesis, based on sequences of three mtDNA genes, finds Lineatriton to be deeply nested within a clade characterized by generalized ecology and morphology. Lineatriton lineolus, the only currently recognized taxon in the genus, shows unanticipated genetic diversity. Surprisingly, geographically separated populations of L. lineolus are not monophyletic, but are sister taxa of different species of the morphologically generalized genus Pseudoeurycea. Lineatriton, long thought to be a unique monospecific lineage, is polyphyletic. Accordingly, the specialized morphology of Lineatriton displays homoplasy at two hierarchical levels: (i) with respect to other elongate lineages in the family (convergence), and (ii) within what is currently recognized as a single taxon (parallelism). These evolutionary events are of adaptive significance because to invade the lowland tropics salamanders must be either arboreal or fossorial; the repeated evolution of elongation and attenuation has led to multiple lowland invasions.
Resumo:
Previously, synaptic activity in the spinal cord of adult mammals was attributed exclusively to chemical neurotransmission. In this study, evidence was obtained for the existence, relative abundance, and widespread distribution of "mixed" (chemical and electrical) synapses on neurons throughout the spinal cords of adult mammals. Using combined confocal microscopy and "grid-mapped freeze fracture," 36 mixed synapses containing 88 "micro" gap junctions (median = 45 connexons) were found and mapped to 33 interneurons and motor neurons in Rexed laminae III-IX in cervical, thoracic, and lumbosacral spinal cords of adult male and female rats. Gap junctions were adjacent to presumptive active zones, where even small gap junctions would be expected to increase synaptic efficacy. Two morphological types of mixed synapse were discerned. One type contained distinctive active zones consisting of "nested" concentric toroidal deformations of pre- and postsynaptic membranes, which, because of their unusual topology, were designated as "synaptic sombreros." A second type had gap junctions adjacent to active zones consisting of broad, flat, shallow indentations of the plasma membrane. Morphometric analysis indicates that mixed synapses correspond to 3-5% of all synapses on the somata and proximal dendrites, but, because of their subcellular location and morphology, they could represent 30-100% of excitatory synapses. The relative abundance of mixed synapses on several classes of neurons in spinal cords of adult rats suggests that mixed synapses provide important but previously unrecognized pathways for bidirectional communication between neurons in the mammalian central nervous system.
Resumo:
The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.