IL-4 inhibits osteoclast formation through a direct action on osteoclast precursors via peroxisome proliferator-activated receptor γ1

IL-4 is a pleiotropic immune cytokine secreted by activated TH2 cells that inhibits bone resorption both in vitro and in vivo. The cellular targets of IL-4 action as well as its intracellular mechanism of action remain to be determined. We show here that IL-4 inhibits receptor activator of NF-κB ligand-induced osteoclast differentiation through an action on osteoclast precursors that is independent of stromal cells. Interestingly, this inhibitory effect can be mimicked by both natural as well as synthetic peroxisome proliferator-activated receptor γ1 (PPARγ1) ligands and can be blocked by the irreversible PPARγ antagonist GW 9662. These findings suggest that the actions of IL-4 on osteoclast differentiation are mediated by PPARγ1, an interpretation strengthened by the observation that IL-4 can activate a PPARγ1-sensitive luciferase reporter gene in RAW264.7 cells. We also show that inhibitors of enzymes such as 12/15-lipoxygenase and the cyclooxygenases that produce known PPARγ1 ligands do not abrogate the IL-4 effect. These findings, together with the observation that bone marrow cells from 12/15-lipoxygenase-deficient mice retain sensitivity to IL-4, suggest that the cytokine may induce novel PPARγ1 ligands. Our results reveal that PPARγ1 plays an important role in the suppression of osteoclast formation by IL-4 and may explain the beneficial effects of the thiazolidinedione class of PPARγ1 ligands on bone loss in diabetic patients.

Role of tumor–host interactions in interstitial diffusion of macromolecules: Cranial vs. subcutaneous tumors

The large size of many novel therapeutics impairs their transport through the tumor extracellular matrix and thus limits their therapeutic effectiveness. We propose that extracellular matrix composition, structure, and distribution determine the transport properties in tumors. Furthermore, because the characteristics of the extracellular matrix largely depend on the tumor–host interactions, we postulate that diffusion of macromolecules will vary with tumor type as well as anatomical location. Diffusion coefficients of macromolecules and liposomes in tumors growing in cranial windows (CWs) and dorsal chambers (DCs) were measured by fluorescence recovery after photobleaching. For the same tumor types, diffusion of large molecules was significantly faster in CW than in DC tumors. The greater diffusional hindrance in DC tumors was correlated with higher levels of collagen type I and its organization into fibrils. For molecules with diameters comparable to the interfibrillar space the diffusion was 5- to 10-fold slower in DC than in CW tumors. The slower diffusion in DC tumors was associated with a higher density of host stromal cells that synthesize and organize collagen type I. Our results point to the necessity of developing site-specific drug carriers to improve the delivery of molecular medicine to solid tumors.

Thymus transplantation, a critical factor for correction of autoimmune disease in aging MRL/+mice.

MRL/MP-+/+ (MRL/+) mice develop pancreatitis and sialoadenitis after they reach 7 months of age. Conventional bone marrow transplantation has been found to be ineffective in the treatment of these forms of apparent autoimmune disease. Old MRL/+ mice show a dramatic thymic involution with age. Hematolymphoid reconstitution is incomplete when fetal liver cells (as a source of hemopoietic stem cells) plus fetal bone (FB; which is used to recruit stromal cells) are transplanted from immunologically normal C57BL/6 donor mice to MRL/+ female recipients. Embryonic thymus from allogeneic C57BL/6 donors was therefore engrafted along with either bone marrow or fetal hematopoietic cells (FHCs) plus fragments of adult or fetal bone. More than seventy percent of old MRL/+ mice (> 7 months) that had been given a fetal thymus (FT) transplant plus either bone marrow or FHCs and also bone fragments survived more than 100 days after treatment. The mice that received FHCs, FB, plus FT from allogeneic donors developed normal T cell and B cell functions. Serum amylase levels decreased in these mice whereas they increased in the mice that received FHCs and FB but not FT. The pancreatitis and sialoadenitis already present at the time of transplantations were fully corrected according to histological analysis by transplants of allogeneic FHCs, FB and FT in the MRL/+ mice. These findings are taken as an experimental indication that perhaps stem cell transplants along with FT grafts might represent a useful strategy for treatment of autoimmune diseases in aged humans.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Cannabinoid ligand-receptor signaling in the mouse uterus.

Using RNA (Northern) blot hybridization and reverse transcription-PCR, we demonstrate that the brain-type cannabinoid receptor (CB1-R) mRNA, but not the spleen-type cannabinoid receptor (CB2-R) mRNA, is expressed in the mouse uterus and that this organ has the capacity to synthesize the putative endogenous cannabinoid ligand, anandamide (arachidonylethanolamide). The psychoactive cannabinoid component of marijuana--delta 9-tetrahydrocannabinol (THC)--or anandamide, but not the inactive and nonpsychoactive cannabidiol (CBD), inhibited forskolin-stimulated cyclic AMP formation in the mouse uterus, which was prevented by pertussis toxin pretreatment. These results suggest that uterine CB1-R is coupled to inhibitory guanine nucleotide-binding protein and is biologically active. Autoradiographic studies identified ligand binding sites ([3H]anandamide) in the uterine epithelium and stromal cells, suggesting that these cells are perhaps the targets for cannabinoid action. Scatchard analysis of the binding of [3H]WIN 55212-2, another cannabinoid receptor ligand, showed a single class of high-affinity binding sites in the endometrium with an apparent Kd of 2.4 nM and Bmax of 5.4 x 10(9) molecules per mg of protein. The gene encoding lactoferrin is an estrogen-responsive gene in the mouse uterus that was rapidly and transiently up-regulated by THC, but not by CBD, in ovariectomized mice in the absence of ovarian steroids. This effect, unlike that of 17 beta-estradiol (E2), was not influenced by a pure antiestrogen, ICI 182780, suggesting that the THC-induced uterine lactoferrin gene expression does not involve estrogen receptors. We propose that the uterus is a new target for cannabinoid ligand-receptor signaling.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Primary Mesenchymal Cells Isolated from SPARC-null Mice Exhibit Altered Morphology and Rates of Proliferation

SPARC (secreted protein acidic and rich in cysteine)/BM 40/osteonectin is a matricellular protein shown to function as a counteradhesive factor that induces cell rounding and as an inhibitor of cell proliferation. These activities have been defined in cell culture, in which interpretation has been complicated by the presence of endogenous SPARC. We therefore sought to determine whether cell shape and proliferation would be affected by the absence of SPARC. Mesangial cells, fibroblasts, and aortic smooth muscle cells were isolated from SPARC-null and age-matched, wild-type mice. In contrast to wild-type cells, SPARC-null mesangial cells exhibited a flat morphology and an altered actin cytoskeleton. In addition, vinculin-containing focal adhesions were distributed over the center of SPARC-null cells, whereas in wild-type cells, the number of focal adhesions was reduced, and these structures were restricted largely to the cell periphery. Although the SPARC-null fibroblasts did not display overt differences in cell morphology, the cells responded to exogenous recombinant SPARC by rounding up in a manner similar to that of wild-type fibroblasts. Thus, the expression of endogenous SPARC is not required for the response of cells to SPARC. Additionally, SPARC-null mesangial cells, fibroblasts, and smooth muscle cells proliferated faster than their respective wild-type counterparts. Null cells also showed a greater sensitivity to the inhibition of cell cycle progression by the addition of recombinant SPARC. The increased proliferation rate of SPARC-null cells appeared to be mediated, at least in part, by an increase in the cell cycle regulatory protein cyclin A. We conclude that the expression of SPARC influences the cellular architecture of mesangial cells and that SPARC plays a role in the regulation of cell cycle in mesangial cells, fibroblasts, and smooth muscle cells.

Differentiation of embryonic mesenchymal cells to odontoblast-like cells by overexpression of dentin matrix protein 1

Cells of the craniofacial skeleton are derived from a common mesenchymal progenitor. The regulatory factors that control their differentiation into various cell lineages are unknown. To investigate the biological function of dentin matrix protein 1 (DMP1), an extracellular matrix gene involved in calcified tissue formation, stable transgenic cell lines and adenovirally infected cells overexpressing DMP1 were generated. The findings in this paper demonstrate that overexpression of DMP1 in pluripotent and mesenchyme-derived cells such as C3H10T1/2, MC3T3-E1, and RPC-C2A can induce these cells to differentiate and form functional odontoblast-like cells. Functional differentiation of odontoblasts requires unique sets of genes being turned on and off in a growth- and differentiation-specific manner. The genes studied include transcription factors like core binding factor 1 (Cbfa1), bone morphogenetic protein 2 (BMP2), and BMP4; early markers for extracellular matrix deposition like alkaline phosphatase (ALP), osteopontin, osteonectin, and osteocalcin; and late markers like DMP2 and dentin sialoprotein (DSP) that are expressed by terminally differentiated odontoblasts and are responsible for the formation of tissue-specific dentin matrix. However, this differentiation pathway was limited to mesenchyme-derived cells only. Other cell lines tested by the adenoviral expression system failed to express odontoblast-phenotypic specific genes. An in vitro mineralized nodule formation assay demonstrated that overexpressed cells could differentiate and form a mineralized matrix. Furthermore, we also demonstrate that phosphorylation of Cbfa1 (osteoblast-specific transcription factor) was not required for the expression of odontoblast-specific genes, indicating the involvement of other unidentified odontoblast-specific transcription factors or coactivators. Cell lines that differentiate into odontoblast-like cells are useful tools for studying the mechanism involved in the terminal differentiation process of these postmitotic cells.

CXCR4 and CD4 mediate a rapid CD95-independent cell death in CD4+ T cells

AIDS is characterized by a progressive decrease of CD4+ helper T lymphocytes. Destruction of these cells may involve programmed cell death, apoptosis. It has previously been reported that apoptosis can be induced even in noninfected cells by HIV-1 gp120 and anti-gp120 antibodies. HIV-1 gp120 binds to T cells via CD4 and the chemokine coreceptor CXCR4 (fusin/LESTR). Therefore, we investigated whether CD4 and CXCR4 mediate gp120-induced apoptosis. We used human peripheral blood lymphocytes, malignant T cells, and CD4/CXCR4 transfectants, and found cell death induced by both cell surface receptors, CD4 and CXCR4. The induced cell death was rapid, independent of known caspases, and lacking oligonucleosomal DNA fragmentation. In addition, the death signals were not propagated via p56lck and Giα. However, the cells showed chromatin condensation, morphological shrinkage, membrane inversion, and reduced mitochondrial transmembrane potential indicative of apoptosis. Significantly, apoptosis was exclusively observed in CD4+ but not in CD8+ T cells, and apoptosis triggered via CXCR4 was inhibited by stromal cell-derived factor-1, the natural CXCR4 ligand. Thus, this mechanism of apoptosis might contribute to T cell depletion in AIDS and might have major implications for therapeutic intervention.

The CXC chemokine stromal cell-derived factor 1 is not responsible for CD8+ T cell suppression of syncytia-inducing strains of HIV-1

Primary CD8+ T cells from HIV+ asymptomatics can suppress virus production from CD4+ T cells acutely infected with either non-syncytia-inducing (NSI) or syncytia-inducing (SI) HIV-1 isolates. NSI strains of HIV-1 predominantly use the CCR5 chemokine receptor as a fusion cofactor, whereas fusion of T cell line-adapted SI isolates is mediated by another chemokine receptor, CXCR4. The CCR5 ligands RANTES (regulated on activation, normal T cell expressed and secreted), macrophage inflammatory protein 1α (MIP-1α), and MIP-1β are HIV-1 suppressive factors secreted by CD8+ cells that inhibit NSI viruses. Recently, the CXC chemokine stromal cell-derived factor 1 (SDF-1) was identified as a ligand for CXCR4 and shown to inhibit SI strains. We speculated that SDF-1 might be an effector molecule for CD8+ suppression of SI isolates and assessed several SDF-1 preparations for inhibition of HIV-1LAI-mediated cell–cell fusion, and examined levels of SDF-1 transcripts in CD8+ T cells. SDF-1 fusion inhibitory activity correlated with the N terminus, and the α and β forms of SDF-1 exhibited equivalent fusion blocking activity. SDF-1 preparations having the N terminus described by Bleul et al. (Bleul, C.C., Fuhlbrigge, R.C., Casasnovas, J.M., Aiuti, A. & Springer, T.A. (1996) J. Exp. Med. 184, 1101–1109) readily blocked HIV-1LAI-mediated fusion, whereas forms containing two or three additional N-terminal amino acids lacked this activity despite their ability to bind and/or signal through CXCR4. Though SDF-1 is constitutively expressed in most tissues, CD8 T cells contained extremely low levels of SDF-1 mRNA transcripts (<1 transcript/5,000 cells), and these levels did not correlate with virus suppressive activity. We conclude that suppression of SI strains of HIV-1 by CD8+ T cells is unlikely to involve SDF-1.

Rho-stimulated Contractility Contributes to the Fibroblastic Phenotype of Ras-transformed Epithelial Cells

Oncogenic transformation of cells alters their morphology, cytoskeletal organization, and adhesive interactions. When the mammary epithelial cell line MCF10A is transformed by activated H-Ras, the cells display a mesenchymal/fibroblastic morphology with decreased cell–cell junctions but increased focal adhesions and stress fibers. We have investigated whether the transformed phenotype is due to Rho activation. The Ras-transformed MCF10A cells have elevated levels of myosin light chain phosphorylation and are more contractile than their normal counterparts, consistent with the activation of Rho. Furthermore, inhibitors of contractility restore a more normal epithelial phenotype to the Ras-transformed MCF10A cells. However, inhibiting Rho by microinjection of C3 exotransferase or dominant negative RhoA only partially restores the normal phenotype, in that it fails to restore normal junctional organization. This result prompted us to examine the effect that inhibiting Rho would have on the junctions of normal MCF10A cells. We have found that inhibiting Rho by C3 microinjection leads to a disruption of E-cadherin cytoskeletal links in adherens junctions and blocks the assembly of new adherens junctions. The introduction of constitutively active Rho into normal MCF10A cells did not mimic the Ras-transformed phenotype. Thus, these results lead us to conclude that some, but not all, characteristics of Ras-transformed epithelial cells are due to activated Rho. Whereas Rho is needed for the assembly of adherens junctions, high levels of activated Rho in Ras-transformed cells contribute to their altered cytoskeletal organization. However, additional events triggered by Ras must also be required for the disruption of adherens junctions and the full development of the transformed epithelial phenotype.

Molecular cloning and characterization of a murine pre-B-cell growth-stimulating factor/stromal cell-derived factor 1 receptor, a murine homolog of the human immunodeficiency virus 1 entry coreceptor fusin

Pre-B-cell growth-stimulating factor/stromal cell-derived factor 1 (PBSF/SDF-1) is a member of the CXC group of chemokines that is initially identified as a bone marrow stromal cell-derived factor and as a pre-B-cell stimulatory factor. Although most chemokines are thought to be inducible inflammatory mediators, PBSF/SDF-1 is essential for perinatal viability, B lymphopoiesis, bone marrow myelopoiesis, and cardiac ventricular septal formation, and it has chemotactic activities on resting lymphocytes and monocytes. In this paper, we have isolated a cDNA that encodes a seven transmembrane-spanning-domain receptor, designated pre-B-cell-derived chemokine receptor (PB-CKR) from a murine pre-B-cell clone, DW34. The deduced amino acid sequence has 90% identity with that of a HUMSTSR/fusin, a human immunodeficiency virus 1 (HIV-1) entry coreceptor. However, the second extracellular region has lower identity (67%) compared with HUMSTSR/fusin. PB-CKR is expressed during embryo genesis and in many organs and T cells of adult mice. Murine PBSF/SDF-1 induced an increase in intracellular free Ca2+ in DW34 cells and PB-CKR-transfected Chinese hamster ovary (CHO) cells, suggesting that PB-CKR is a functional receptor for murine PBSF/SDF-1. Murine PBSF/SDF-1 also induced Ca2+ influx in fusin-transfected CHO cells. On the other hand, considering previous results that HIV-1 does not enter murine T cells that expressed human CD4, PB-CKR may not support HIV-1 infection. Thus, PB-CKR will be an important tool for functional mapping of HIV-1 entry coreceptor fusin and for understanding the function of PBSF/SDF-1 further.

Results of MDR-1 vector modification trial indicate that granulocyte/macrophage colony-forming unit cells do not contribute to posttransplant hematopoietic recovery following intensive systemic therapy

To formally test the hypothesis that the granulocyte/macrophage colony-forming unit (GM-CFU) cells can contribute to early hematopoietic reconstitution immediately after transplant, the frequency of genetically modified GM-CFU after retroviral vector transduction was measured by a quantitative in situ polymerase chain reaction (PCR), which is specific for the multidrug resistance-1 (MDR-1) vector, and by a quantitative GM-CFU methylcellulose plating assay. The results of this analysis showed no difference between the transduction frequency in the products of two different transduction protocols: “suspension transduction” and “stromal growth factor transduction.” However, when an analysis of the frequency of cells positive for the retroviral MDR-1 vector posttransplantation was carried out, 0 of 10 patients transplanted with cells transduced by the suspension method were positive for the vector MDR-1 posttransplant, whereas 5 of 8 patients transplanted with the cells transduced by the stromal growth factor method were positive for the MDR-1 vector transcription unit by in situ or in solution PCR assay (a difference that is significant at the P = 0.0065 level by the Fisher exact test). These data suggest that only very small subsets of the GM-CFU fraction of myeloid cells, if any, contribute to the repopulation of the hematopoietic tissues that occurs following intensive systemic therapy and transplantation of autologous hematopoietic cells.

E-cadherin induces mesenchymal-to-epithelial transition in human ovarian surface epithelium

Ovarian carcinomas are thought to arise in the ovarian surface epithelium (OSE). Although this tissue forms a simple epithelial covering on the ovarian surface, OSE cells exhibit some mesenchymal characteristics and contain little or no E-cadherin. However, E-cadherin is present in metaplastic OSE cells that resemble the more complex epithelia of the oviduct, endometrium and endocervix, and in primary epithelial ovarian carcinomas. To determine whether E-cadherin was a cause or consequence of OSE metaplasia, we expressed this cell-adhesion molecule in simian virus 40-immortalized OSE cells. In these cells the exogenous E-cadherin, all three catenins, and F-actin localized at sites of cell–cell contact, indicating the formation of functional adherens junctions. Unlike the parent OSE cell line, which had undergone a typical mesenchymal transformation in culture, E-cadherin-expressing cells contained cytokeratins and the tight-junction protein occludin. They also formed cobblestone monolayers in two-dimensional culture and simple epithelia in three-dimensional culture that produced CA125 and shed it into the culture medium. CA125 is a normal epithelial-differentiation product of the oviduct, endometrium, and endocervix, but not of normal OSE. It is also a tumor antigen that is produced by ovarian neoplasms and by metaplastic OSE. Thus, E-cadherin restored some normal characteristics of OSE, such as keratin, and it also induced epithelial-differentiation markers associated with weakly preneoplastic, metaplastic OSE and OSE-derived primary carcinomas. The results suggest an unexpected role for E-cadherin in ovarian neoplastic progression.