57 resultados para Granulocyte


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chronic myelogenous leukemia evolves in two clinically distinct stages: a chronic and a blast crisis phase. The molecular changes associated with chronic phase to blast crisis transition are largely unknown. We have identified a cDNA clone, DR-nm23, differentially expressed in a blast-crisis cDNA library, which has approximately 70% sequence similarity to the putative metastatic suppressor genes, nm23-H1 and nm23-H2. The deduced amino acid sequence similarity to the proteins encoded by these two latter genes is approximately 65% and includes domains and amino acid residues (the leucine zipper-like and the RGD domain, a serine and a histidine residue in the NH2- and in the COOH-terminal portion of the protein, respectively) postulated to be important for nm23 function. DR-nm23 mRNA is preferentially expressed at early stages of myeloid differentiation of highly purified CD34+ cells. Its constitutive expression in the myeloid precursor 32Dc13 cell line, which is growth-factor dependent for both proliferation and differentiation, results in inhibition of granulocytic differentiation induced by granulocyte colony-stimulating factor and causes apoptotic cell death. These results are consistent with a role for DR-nm23 in normal hematopoiesis and raise the possibility that its overexpression contributes to differentiation arrest, a feature of blastic transformation in chronic myelogenous leukemia.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The phosphatidylinositol 3-kinase (PI3K)-signaling pathway has emerged as an important component of cytokine-mediated survival of hemopoietic cells. Recently, the protein kinase PKB/akt (referred to here as PKB) has been identified as a downstream target of PI3K necessary for survival. PKB has also been implicated in the phosphorylation of Bad, potentially linking the survival effects of cytokines with the Bcl-2 family. We have shown that granulocyte/macrophage colony-stimulating factor (GM-CSF) maintains survival in the absence of PI3K activity, and we now show that when PKB activation is also completely blocked, GM-CSF is still able to stimulate phosphorylation of Bad. Interleukin 3 (IL-3), on the other hand, requires PI3K for survival, and blocking PI3K partially inhibited Bad phosphorylation. IL-4, unique among the cytokines in that it lacks the ability to activate the p21ras–mitogen-activated protein kinase (MAPK) cascade, was found to activate PKB and promote cell survival, but it did not stimulate Bad phosphorylation. Finally, although our data suggest that the MAPK pathway is not required for inhibition of apoptosis, we provide evidence that phosphorylation of Bad may be occurring via a MAPK/ERK kinase (MEK)-dependent pathway. Together, these results demonstrate that although PI3K may contribute to phosphorylation of Bad in some instances, there is at least one other PI3K-independent pathway involved, possibly via activation of MEK. Our data also suggest that although phosphorylation of Bad may be one means by which cytokines can inhibit apoptosis, it may be neither sufficient nor necessary for the survival effect.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Erythropoietin (EPO) is required for red blood cell development, but whether EPO-specific signals directly instruct erythroid differentiation is unknown. We used a dominant system in which constitutively active variants of the EPO receptor were introduced into erythroid progenitors in mice. Chimeric receptors were constructed by replacing the cytoplasmic tail of constitutively active variants of the EPO receptor with tails of diverse cytokine receptors. Receptors linked to granulocyte or platelet production supported complete erythroid development in vitro and in vivo, as did the growth hormone receptor, a nonhematopoietic receptor. Therefore, EPOR-specific signals are not required for terminal differentiation of erythrocytes. Furthermore, we found that cellular context can influence cytokine receptor signaling.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human hematopoiesis originates in a population of stem cells with transplantable lympho-myeloid reconstituting potential, but a method for quantitating such cells has not been available. We now describe a simple assay that meets this need. It is based on the ability of sublethally irradiated immunodeficient nonobese diabetic–scid/scid (NOD/SCID) mice to be engrafted by intravenously injected human hematopoietic cells and uses limiting dilution analysis to measure the frequency of human cells that produce both CD34−CD19+ (B-lymphoid) and CD34+ (myeloid) colony-forming cell progeny in the marrow of such recipients 6 to 8 weeks post-transplant. Human cord blood (CB) contains ≈5 of these competitive repopulating units (CRU) per ml that have a similar distribution between the CD38− and CD38+ subsets of CD34+ CB cells as long-term culture-initiating cells (LTC-IC) (4:1 vs. 2:1). Incubation of purified CD34+CD38− human CB cells in serum-free medium containing flt-3 ligand, Steel factor, interleukin 3, interleukin 6, and granulocyte colony-stimulating factor for 5–8 days resulted in a 100-fold expansion of colony-forming cells, a 4-fold expansion of LTC-IC, and a 2-fold (but significant, P < 0.02) increase in CRU. The culture-derived CRU, like the original CB CRU, generated pluripotent, erythroid, granulopoietic, megakaryopoietic, and pre-B cell progeny upon transplantation into NOD/SCID mice. These findings demonstrate an equivalent phenotypic heterogeneity amongst human CB cells detectable as CRU and LTC-IC. In addition, their similarly modest response to stimulation by a combination of cytokines that extensively amplify LTC-IC from normal adult marrow underscores the importance of ontogeny-dependent changes in human hematopoietic stem cell proliferation and self-renewal.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The stimulation by Flk2-ligand (FL) of blast colony formation by murine bone marrow cells was selectively potentiated by the addition of regulators sharing in common the gp130 signaling receptor–leukemia inhibitory factor (LIF), oncostatin M, interleukin 11, or interleukin 6. Recloning of blast colony cells indicated that the majority were progenitor cells committed exclusively to macrophage formation and responding selectively to proliferative stimulation by macrophage colony-stimulating factor. Reculture of blast colony cells initiated by FL plus LIF in cultures containing granulocyte/macrophage colony-stimulating factor plus tumor necrosis factor α indicated that at least some of the cells were capable of maturation to dendritic cells. The cells forming blast colonies in response to FL plus LIF were unrelated to those forming blast colonies in response to stimulation by stem cell factor and appear to be a distinct subset of mature hematopoietic stem cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multiple growth factors synergistically stimulate proliferation of primitive hematopoietic progenitor cells. A human myeloid cell line, KPB-M15, constitutively produces a novel hematopoietic cytokine, termed stem cell growth factor (SCGF), possessing species-specific proliferative activities. Here we report the molecular cloning, expression, and characterization of a cDNA encoding human SCGF using a newly developed λSHDM vector that is more efficient for differential and expression cloning. cDNA for SCGF encodes a 29-kDa polypeptide without N-linked glycosylation. SCGF transiently produced by COS-1 cells supports growth of hematopoietic progenitor cells through a short-term liquid culture of bone marrow cells and exhibits promoting activities on erythroid and granulocyte/macrophage progenitor cells in primary semisolid culture with erythropoietin and granulocyte/macrophage colony-stimulating factor, respectively. Expression of SCGF mRNA is restricted to myeloid cells and fibroblasts, suggesting that SCGF is a growth factor functioning within the hematopoietic microenvironment. SCGF could disclose some human-specific mechanisms as yet unidentified from studies on the murine hematopoietic system.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neutrophils are important effector cells in immunity to microorganisms, particularly bacteria. Here, we show that the process of neutrophil apoptosis is delayed in several inflammatory diseases, suggesting that this phenomenon may represent a general feature contributing to the development of neutrophilia, and, therefore, in many cases to host defense against infection. The delay of neutrophil apoptosis was associated with markedly reduced levels of Bax, a pro-apoptotic member of the Bcl-2 family. Such Bax-deficient cells were also observed upon stimulation of normal neutrophils with cytokines present at sites of neutrophilic inflammation, such as granulocyte and granulocyte–macrophage colony-stimulating factors, in vitro. Moreover, Bax-deficient neutrophils generated by using Bax antisense oligodeoxynucleotides demonstrated delayed apoptosis, providing direct evidence for a role of Bax as a pro-apoptotic molecule in these cells. Interestingly, the Bax gene was reexpressed in Bax-deficient neutrophils under conditions of cytokine withdrawal. Thus, both granulocyte expansion and the resolution of inflammation appear to be regulated by the expression of the Bax gene in neutrophils.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Polymorphonuclear leukocytes are essential for host defense to infectious diseases. CCAAT/enhancer binding protein ɛ (C/EBPɛ) is preferentially expressed in granulocytes and lymphoid cells. Mice with a null mutation in C/EBPɛ develop normally and are fertile but fail to generate functional neutrophils and eosinophils. Opportunistic infections and tissue destruction lead to death by 3–5 months of age. Furthermore, end-stage mice develop myelodysplasia, characterized by proliferation of atypical granulocytes that efface the bone marrow and result in severe tissue destruction. Thus, C/EBPɛ is essential for terminal differentiation and functional maturation of committed granulocyte progenitor cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Identification of cytokine-inducible genes is imperative for determining the mechanisms of cytokine action. A cytokine-inducible gene, mrg1 [melanocyte-specific gene (msg1) related gene], was identified through mRNA differential display of interleukin (IL) 9-stimulated and unstimulated mouse helper T cells. In addition to IL-9, mrg1 can be induced by other cytokines and biological stimuli, including IL-1α, -2, -4, -6, and -11, granulocyte/macrophage colony-stimulating factor, interferon γ, platelet-derived growth factor, insulin, serum, and lipopolysaccharide in diverse cell types. The induction of mrg1 by these stimuli appears to be transient, with induction kinetics similar to other primary response genes, implicating its role in diverse biological processes. Deletion or point mutations of either the Box1 motif (binds Janus kinase 1) or the signal transducer and activator of transcription 3 binding site-containing region within the intracellular domain of the IL-9 receptor ligand binding subunit abolished or greatly reduced mrg1 induction by IL-9, suggesting that the Janus kinase/signal transducer and activator of transcription signaling pathway is required for mrg1 induction, at least in response to IL-9. Transfection of mrg1 cDNA into TS1, an IL-9-dependent mouse T cell line, converted these cells to IL-9-independent growth through a nonautocrine mechanism. Overexpression of mrg1 in Rat1 cells resulted in loss of cell contact inhibition, anchorage-independent growth in soft agar, and tumor formation in nude mice, demonstrating that mrg1 is a transforming gene. MRG1 is a transcriptional activator and may represent a founding member of an additional family of transcription factors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We report herein the successful long term engraftment of highly purified hematopoietic stem cells (HSCs) without any facilitating cells in fully allogeneic recipient mice across the entire major histocompatibility complex (MHC) transplantation barrier. This finding challenges the assumption that highly purified marrow HSCs alone cannot produce long-lived allogeneic bone marrow chimeras across the MHC barrier. In the present experiments, 1 × 105 HSCs from 5-fluorouracil (5-FU)-treated donors, without any facilitating cells, have been found to repopulate lethally irradiated fully allogeneic recipients. Low density, lineage-negative (CD4−, CD8−, B220−, Mac-1−, Gr-1−), CD71-negative, class I highly positive, FACS-sorted cells from 5-FU-treated C57BL/6 (B6) donor mice were transplanted into lethally irradiated BALB/c recipients. (BALB/c → BALB/c) → BALB/c T cell-depleted marrow cells used as compromised cells were also transplanted into the recipients to permit experiments to be pursued over a long period of time. Cells of donor origin in all recognized lineages of hematopoietic cells developed in these allogeneic chimeras. One thousand HSCs were sufficient to repopulate hemiallogeneic recipients, but 1 × 104 HSCs alone from 5-FU-treated donors failed to repopulate the fully allogeneic recipients. Transplantation of primary marrow stromal cells or bones of the donor strain into recipient, together with 1 × 104 HSCs, also failed to reconstitute fully allogeneic recipients. Suppression of resistance of recipients by thymectomy or injections of granulocyte colony-stimulating factor before stem cell transplantation enhanced the engraftment of allogeneic HSCs. Our experiments show that reconstitution of all lymphohematopoietic lineages across the entire MHC transplantation barriers may be achieved by transplanting allogeneic HSCs alone, without any facilitating cells, as long as a sufficient number of HSCs is transplanted.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Transforming growth factor β (TGFβ) family ligands initiate a cascade of events capable of modulating cellular growth and differentiation. The receptors responsible for transducing these cellular signals are referred to as the type I and type II TGFβ receptors. Ligand binding to the type II receptor results in the transphosphorylation and activation of the type I receptor. This heteromeric complex then propagates the signal(s) to downstream effectors. There is presently little data concerning the fate of TGFβ receptors after ligand binding, with conflicting reports indicating no change or decreasing cell surface receptor numbers. To address the fate of ligand-activated receptors, we have used our previously characterized chimeric receptors consisting of the ligand binding domain from the granulocyte/macrophage colony-stimulating factor α or β receptor fused to the transmembrane and cytoplasmic domain of the type I or type II TGFβ receptor. This system not only provides the necessary sensitivity and specificity to address these types of questions but also permits the differentiation of endocytic responses to either homomeric or heteromeric intracellular TGFβ receptor oligomerization. Data are presented that show, within minutes of ligand binding, chimeric TGFβ receptors are internalized. However, although all the chimeric receptor combinations show similar internalization rates, receptor down-regulation occurs only after activation of heteromeric TGFβ receptors. These results indicate that effective receptor down-regulation requires cross-talk between the type I and type II TGFβ receptors and that TGFβ receptor heteromers and homomers show distinct trafficking behavior.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

5-lipoxygenase (5-LO) catalyzes the initial steps in the formation of leukotrienes, a group of inflammatory mediators derived from arachidonic acid (AA). Here we describe that activation of p38 mitogen-activated protein kinase in human polymorphonuclear leukocytes and in Mono Mac 6 cells leads to activation of downstream kinases, which can subsequently phosphorylate 5-LO in vitro. Different agents activated the 5-LO kinase activities, including stimuli for cellular leukotriene biosynthesis (A23187, thapsigargin, N-formyl-leucyl-phenylalanine), compounds that up-regulate the capacity for leukotriene biosynthesis (phorbol 12-myristate 13-acetate, tumor necrosis factor α, granulocyte/macrophage colony-stimulating factor), and well known p38 stimuli as sodium arsenite and sorbitol. For all stimuli, 5-LO kinase activation was counteracted by SB203580 (3 μM or less), an inhibitor of p38 kinase. At least two p38-dependent 5-LO kinase activities were found. Based on migration properties in in-gel kinase assays and immunoreactivity, one of these was identified as mitogen-activated protein kinase-activated protein kinase 2 (MAPKAP kinase 2). The other appeared to be MAPKAP kinase 3; however, it could not be excluded that also other p38-dependent kinases contributed. When polymorphonuclear leukocytes were incubated with sodium arsenite (strong activator of 5-LO kinases), platelet-activating factor and exogenous AA, there was a 4-fold increase in 5-LO activity as compared with incubations with only platelet-activating factor and AA. This indicates that 5-LO phosphorylation can be one factor determining cellular 5-LO activity.