Subcutaneous vaccination with irradiated, cytokine-producing tumor cells stimulates CD8+ cell-mediated immunity against tumors located in the "immunologically privileged" central nervous system.

Vaccination with cytokine-producing tumor cells generates potent immune responses against tumors outside the central nervous system (CNS). The CNS, however, is a barrier to allograft and xenograft rejection, and established tumors within the CNS have failed to respond to other forms of systemic immunotherapy. To determine what barriers the "immunologically privileged" CNS would pose to cytokine-assisted tumor vaccines and what cytokines would be most efficacious against tumors within the CNS, we irradiated B16 murine melanoma cells producing murine interleukin 2 (IL-2), IL-3, IL-4, IL-6, gamma-interferon, or granulocyte-macrophage colony stimulating factor (GM-CSF) and used these cells as subcutaneous vaccines against tumors within the brain. Under conditions where untransfected B16 cells had no effect, cells producing IL-3, IL-6, or GM-CSF increased the survival of mice challenged with viable B16 cells in the brain. Vaccination with B16 cells producing IL-4 or gamma-interferon had no effect, and vaccination with B16 cells producing IL-2 decreased survival time. GM-CSF-producing vaccines were also able to increase survival in mice with pre-established tumors. The response elicited by GM-CSF-producing vaccines was found to be specific to tumor type and to be abrogated by depletion of CD8+ cells. Unlike the immunity generated against subcutaneous tumors by GM-CSF, however, the effector responses generated against tumors in the CNS were not dependent on CD4+ cells. These data suggest that cytokine-producing tumor cells are very potent stimulators of immunity against tumors within the CNS, but effector responses in the CNS may be different from those obtained against subcutaneous tumors.

Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Constitutive production of granulocyte/macrophage colony-stimulating factor by hypodense mononuclear eosinophils developed in vitro from hybrid eosinophil/basophil granulocytes.

We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Dissociation of cytokine-induced phosphorylation of Bad and activation of PKB/akt: Involvement of MEK upstream of Bad phosphorylation

The phosphatidylinositol 3-kinase (PI3K)-signaling pathway has emerged as an important component of cytokine-mediated survival of hemopoietic cells. Recently, the protein kinase PKB/akt (referred to here as PKB) has been identified as a downstream target of PI3K necessary for survival. PKB has also been implicated in the phosphorylation of Bad, potentially linking the survival effects of cytokines with the Bcl-2 family. We have shown that granulocyte/macrophage colony-stimulating factor (GM-CSF) maintains survival in the absence of PI3K activity, and we now show that when PKB activation is also completely blocked, GM-CSF is still able to stimulate phosphorylation of Bad. Interleukin 3 (IL-3), on the other hand, requires PI3K for survival, and blocking PI3K partially inhibited Bad phosphorylation. IL-4, unique among the cytokines in that it lacks the ability to activate the p21ras–mitogen-activated protein kinase (MAPK) cascade, was found to activate PKB and promote cell survival, but it did not stimulate Bad phosphorylation. Finally, although our data suggest that the MAPK pathway is not required for inhibition of apoptosis, we provide evidence that phosphorylation of Bad may be occurring via a MAPK/ERK kinase (MEK)-dependent pathway. Together, these results demonstrate that although PI3K may contribute to phosphorylation of Bad in some instances, there is at least one other PI3K-independent pathway involved, possibly via activation of MEK. Our data also suggest that although phosphorylation of Bad may be one means by which cytokines can inhibit apoptosis, it may be neither sufficient nor necessary for the survival effect.

Constitutive and impaired signaling of leptin receptors containing the Gln → Pro extracellular domain fatty mutation

Leptin (OB), an adipocyte-secreted circulating hormone, and its receptor (OB-R) are key components of an endocrine loop that regulates mammalian body weight. In this report we have analyzed signal transduction activities of OB-R containing the fatty mutation [OB-R(fa)], a single amino acid substitution at position 269 (Gln → Pro) in the OB-R extracellular domain that results in the obese phenotype of the fatty rat. We find that this mutant receptor exhibits both ligand-independent transcriptional activation via interleukin 6 and hematopoietin receptor response elements and ligand-independent activation of signal transducer and activator of transcription (STAT) proteins 1 and 3. However, OB-R(fa) is unable to constitutively activate STAT5B and is highly impaired for ligand induced activation of STAT5B compared with OB-R(wt). Introduction of the fatty mutation into a OB-R/G-CSF-R chimera generates a receptor with constitutive character that is similar but distinct from that of OB-R(fa). Constitutive mutant OB-R(fa) receptor signaling is repressed by coexpression of OB-R(wt). The implications of an extracellular domain amino acid substitution generating a cytokine receptor with a partially constitutive phenotype are discussed both in terms of the mechanism of OB-R triggering and the biology of the fatty rat.

Chimeric Cytokine Receptor Can Transduce Expansion Signals in Interleukin 6 Receptor α (IL-6Rα)-, IL-11Rα-, and gp130-low to -negative Primitive Hematopoietic Progenitors

We generated transgenic mice expressing chimeric receptors, which comprise extracellular domains of the human granulocyte–macrophage colony-stimulating factor (hGM-CSF) receptor and transmembrane and cytoplasmic domains of the mouse leukemia inhibitory factor receptor. In suspension cultures of lineage-negative (Lin−), 5-fluorouracil-resistant bone marrow cells of the transgenic mice, a combination of hGM-CSF and stem cell factor (SCF) induced exponential expansions of mixed colony-forming unit. The combination of hGM-CSF and SCF was effective on enriched, Lin−Sca-1+c-kit+ progenitors and increased either mixed colony-forming unit or cobblestone area–forming cells. In case of stimulation with hGM-CSF and SCF, interleukin-6 (IL-6) and SCF, or IL-11 and SCF, the most efficient expansion was achieved with hGM-CSF and SCF. When Lin−Sca-1+c-kit+CD34− further enriched progenitors were clone sorted and individually incubated in the presence of SCF, hGM-CSF stimulated a larger number of cells than did IL-6, IL-6 and soluble IL-6 receptor (IL-6R), or IL-11. These data suggest the presence of IL-6Rα-, IL-11Rα-, and gp130-low to -negative primitive hematopoietic progenitors. Such primitive progenitors are equipped with signal transduction molecules and can expand when these chimeric receptors are genetically introduced into the cells and stimulated with hGM-CSF in the presence of SCF.

C/EBPɛ mediates myeloid differentiation and is regulated by the CCAAT displacement protein (CDP/cut)

Neutrophils from CCAAT enhancer binding protein epsilon (C/EBPɛ) knockout mice have morphological and biochemical features similar to those observed in patients with an extremely rare congenital disorder called neutrophil-specific secondary granule deficiency (SGD). SGD is characterized by frequent bacterial infections attributed, in part, to the lack of neutrophil secondary granule proteins (SGP). A mutation that results in loss of functional C/EBPɛ activity has recently been described in an SGD patient, and has been postulated to be the cause of the disease in this patient. We have previously demonstrated that overexpression of CCAAT displacement protein (CDP/cut), a highly conserved transcriptional repressor of developmentally regulated genes, suppresses expression of SGP genes in 32Dcl3 cells. This phenotype resembles that observed in both C/EBPɛ−/− mice and in SGD patients. Based on these observations we investigated potential interactions between C/EBPɛ and CDP/cut during neutrophil maturation. In this study, we demonstrate that inducible expression of C/EBPɛ in 32Dcl3/tet cells results in granulocytic differentiation. Furthermore, Northern blot analysis of G-CSF-induced CDP/cut overexpressing 32Dcl3 cells revealed absence of C/EBPɛ mRNA. We therefore hypothesize that C/EBPɛ positively regulates SGP gene expression, and that C/EBPɛ is itself negatively regulated by CDP/cut during neutrophil maturation. We further demonstrate that the C/EBPɛ promoter is regulated by CDP/cut during myeloid differentiation.

The "allosteric three-site model" of elongation cannot be confirmed in a well-defined ribosome system from Escherichia coli.

For the functional role of the ribosomal tRNA exit (E) site, two different models have been proposed. It has been suggested that transient E-site binding of the tRNA leaving the peptidyl (P) site promotes elongation factor G (EF-G)-dependent translocation by lowering the energetic barrier of tRNA release [Lill, R., Robertson, J. M. & Wintermeyer, W. (1989) EMBO J. 8, 3933-3938]. The alternative "allosteric three-site model" [Nierhaus, K.H. (1990) Biochemistry 29, 4997-5008] features stable, codon-dependent tRNA binding to the E site and postulates a coupling between E and aminoacyl (A) sites that regulates the tRNA binding affinity of the two sites in an anticooperative manner. Extending our testing of the two conflicting models, we have performed translocation experiments with fully active ribosomes programmed with heteropolymeric mRNA. The results confirm that the deacylated tRNA released from the P site is bound to the E site in a kinetically labile fashion, and that the affinity of binding, i.e., the occupancy of the E site, is increased by Mg2+ or polyamines. At conditions of high E-site occupancy in the posttranslocation complex, filling the A site with aminoacyl-tRNA had no influence on the E site, i.e., there was no detectable anticooperative coupling between the two sites, provided that second-round translocation was avoided by removing EF-G. On the basis of these results, which are entirely consistent with our previous results, we consider the allosteric three-site model of elongation untenable. Rather, as proposed earlier, the E site-bound state of the leaving tRNA is a transient intermediate and, as such, is a mechanistic feature of the classic two-state model of the elongating ribosome.

UGA suppression by a mutant RNA of the large ribosomal subunit.

A role for rRNA in peptide chain termination was indicated several years ago by isolation of a 168 rRNA (small subunit) mutant of Escherichia coli that suppressed UGA mutations. In this paper, we describe another interesting rRNA mutant, selected as a translational suppressor of the chain-terminating mutant trpA (UGA211) of E. coli. The finding that it suppresses UGA at two positions in trpA and does not suppress the other two termination codons, UAA and UAG, at the same codon positions (or several missense mutations, including UGG, available at one of the two positions) suggests a defect in UGA-specific termination. The suppressor mutation was mapped by plasmid fragment exchanges and in vivo suppression to domain II of the 23S rRNA gene of the rrnB operon. Sequence analysis revealed a single base change of G to A at residue 1093, an almost universally conserved base in a highly conserved region known to have specific interactions with ribosomal proteins, elongation factor G, tRNA in the A-site, and the peptidyltransferase region of 23S rRNA. Several avenues of action of the suppressor mutation are suggested, including altered interactions with release factors, ribosomal protein L11, or 16S rRNA. Regardless of the mechanism, the results indicate that a particular residue in 23S rRNA affects peptide chain termination, specifically in decoding of the UGA termination codon.

F-actin and G-actin binding are uncoupled by mutation of conserved tyrosine residues in maize actin depolymerizing factor (ZmADF)

Actin depolymerizing factors (ADF) are stimulus responsive actin cytoskeleton modulating proteins. They bind both monomeric actin (G-actin) and filamentous actin (F-actin) and, under certain conditions, F-actin binding is followed by filament severing. In this paper, using mutant maize ADF3 proteins, we demonstrate that the maize ADF3 binding of F-actin can be spatially distinguished from that of G-actin. One mutant, zmadf3–1, in which Tyr-103 and Ala-104 (equivalent to destrin Tyr-117 and Ala-118) have been replaced by phenylalanine and glycine, respectively, binds more weakly to both G-actin and F-actin compared with maize ADF3. A second mutant, zmadf3–2, in which both Tyr-67 and Tyr-70 are replaced by phenylalanine, shows an affinity for G-actin similar to maize ADF3, but F-actin binding is abolished. The two tyrosines, Tyr-67 and Tyr-70, are in the equivalent position to Tyr-82 and Tyr-85 of destrin, respectively. Using the tertiary structure of destrin, yeast cofilin, and Acanthamoeba actophorin, we discuss the implications of removing the aromatic hydroxyls of Tyr-82 and Tyr-85 (i.e., the effect of substituting phenylalanine for tyrosine) and conclude that Tyr-82 plays a critical role in stabilizing the tertiary structure that is essential for F-actin binding. We propose that this tertiary structure is maintained as a result of a hydrogen bond between the hydroxyl of Tyr-82 and the carbonyl of Tyr-117, which is located in the long α-helix; amino acid components of this helix (Leu-111 to Phe-128) have been implicated in G-actin and F-actin binding. The structures of human destrin and yeast cofilin indicate a hydrogen distance of 2.61 and 2.77 Å, respectively, with corresponding bond angles of 99.5° and 113°, close to the optimum for a strong hydrogen bond.

Guanine nucleotide exchange factor GEF115 specifically mediates activation of Rho and serum response factor by the G protein α subunit Gα13

Signal transduction pathways that mediate activation of serum response factor (SRF) by heterotrimeric G protein α subunits were characterized in transfection systems. Gαq, Gα12, and Gα13, but not Gαi, activate SRF through RhoA. When Gαq, α12, or α13 were coexpressed with a Rho-specific guanine nucleotide exchange factor GEF115, Gα13, but not Gαq or Gα12, showed synergistic activation of SRF with GEF115. The synergy between Gα13 and GEF115 depends on the N-terminal part of GEF115, and there was no synergistic effect between Gα13 and another Rho-specific exchange factor Lbc. In addition, the Dbl-homology (DH)-domain-deletion mutant of GEF115 inhibited Gα13- and Gα12-induced, but not GEF115 itself- or Gαq-induced, SRF activation. The DH-domain-deletion mutant also suppressed thrombin- and lysophosphatidic acid-induced SRF activation in NIH 3T3 cells, probably by inhibition of Gα12/13. The N-terminal part of GEF115 contains a sequence motif that is homologous to the regulator of G protein signaling (RGS) domain of RGS12. RGS12 can inhibit both Gα12 and Gα13. Thus, the inhibition of Gα12/13 by the DH-deletion mutant may be due to the RGS activity of the mutant. The synergism between Gα13 and GEF115 indicates that GEF115 mediates Gα13-induced activation of Rho and SRF.