19 resultados para Core promoter


Relevância:

30.00% 30.00%

Publicador:

Resumo:

γ-Crystallin genes are specifically expressed in the eye lens. Their promoters constitute excellent models to analyse tissue-specific gene expression. We investigated murine Cryge/f promoters of different length in lens epithelial cell lines. The most active fragment extends from position –219 to +37. Computer analysis predicts homeodomain and paired-domain binding sites for all rodent Crygd/e/f core promoters. As examples, we analysed the effects of Prox1 and Six3, which are considered important transcription factors involved in lens development. Because of endogenous Prox1 expression in N/N1003A cells, a weak stimulation of Cryge/f promoter activity was found for PROX1. In contrast, PROX1 stimulated the Crygf promoter 10-fold in CD5A cells without endogenous PROX1. In both cell lines Six3 repressed the Crygf promoter to 10% of its basal activity. Our cell transfection experiments indicated that Cryg expression increases as Six3 expression decreases. Prox1 and Six3 act antagonistically on regulation of the Crygd/e/f promoters. Functional assays using randomly mutated γF-crystallin promoter fragments define a Six3-responsive element between –101 and –123 and a Prox1-responsive element between –151 and –174. Since Prox1 and Six3 are present at the beginning of lens development, expression of Crygd/e/f is predicted to remain low at this time. It increases as Six3 expression decreases during ongoing lens development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The mouse mammary tumor virus (MMTV) promoter is regulated by steroid hormones through a hormone-responsive region that is organized in a positioned nucleosome. Hormone induction leads to a structural change of this nucleosome which makes its DNA more sensitive to cleavage by DNase I and enables simultaneous binding of all relevant transcription factors. In cells carrying either episomal or chromosomally integrated MMTV promoters, moderate acetylation of core histones, generated by treatment with low concentrations of the histone deacetylase inhibitors sodium butyrate or trichostatin A, enhances transcription from the MMTV promoter in the absence of hormone and potentiates transactivation by either glucocorticoids or progestins. At higher concentrations, histone deacetylase inhibitors reduce basal and hormone induced MMTV transcription. Inducing inhibitor concentrations lead to the same type of nucleosomal DNase I hypersensitivity as hormone treatment, suggesting that moderate acetylation of core histone activates the MMTV promoter by mechanisms involving chromatin remodeling similar to that generated by the inducing hormones.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the presence of m-xylene, the Pu promoter of the TOL plasmid of Pseudomonas putida is activated by the prokaryotic enhancer-binding protein XylR. The intervening DNA segment between the upstream activating sequences (UASs) and those for RNA polymerase binding contains an integration host factor (IHF) attachment site that is required for full transcriptional activity. In the absence of IHF, the Pu promoter can be cross-activated by other members of the sigma 54-dependent family of regulatory proteins. Such illegitimate activation does not require the binding of the heterologous regulators to DNA and it is suppressed by bent DNA structures, either static or protein induced, between the promoter core elements (UAS and RNA polymerase recognition sequence). The role of IHF in some sigma 54 promoters is, therefore, not only a structural aid for assembling a correct promoter geometry but also that of an active suppressor (restrictor) of promiscuous activation by heterologous regulators for increased promoter specificity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.