84 resultados para Colony-stimulating-factor


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The peroxisome proliferator-activated receptor γ (PPARγ) is a ligand-dependent transcription factor that has been demonstrated to regulate fat cell development and glucose homeostasis. PPARγ is also expressed in a subset of macrophages and negatively regulates the expression of several proinflammatory genes in response to natural and synthetic ligands. We here demonstrate that PPARγ is expressed in macrophage foam cells of human atherosclerotic lesions, in a pattern that is highly correlated with that of oxidation-specific epitopes. Oxidized low density lipoprotein (oxLDL) and macrophage colony-stimulating factor, which are known to be present in atherosclerotic lesions, stimulated PPARγ expression in primary macrophages and monocytic cell lines. PPARγ mRNA expression was also induced in primary macrophages and THP-1 monocytic leukemia cells by the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA). Inhibition of protein kinase C blocked the induction of PPARγ expression by TPA, but not by oxLDL, suggesting that more than one signaling pathway regulates PPARγ expression in macrophages. TPA induced the expression of PPARγ in RAW 264.7 macrophages by increasing transcription from the PPARγ1 and PPARγ3 promoters. In concert, these observations provide insights into the regulation of PPARγ expression in activated macrophages and raise the possibility that PPARγ ligands may influence the progression of atherosclerosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Multiple growth factors synergistically stimulate proliferation of primitive hematopoietic progenitor cells. A human myeloid cell line, KPB-M15, constitutively produces a novel hematopoietic cytokine, termed stem cell growth factor (SCGF), possessing species-specific proliferative activities. Here we report the molecular cloning, expression, and characterization of a cDNA encoding human SCGF using a newly developed λSHDM vector that is more efficient for differential and expression cloning. cDNA for SCGF encodes a 29-kDa polypeptide without N-linked glycosylation. SCGF transiently produced by COS-1 cells supports growth of hematopoietic progenitor cells through a short-term liquid culture of bone marrow cells and exhibits promoting activities on erythroid and granulocyte/macrophage progenitor cells in primary semisolid culture with erythropoietin and granulocyte/macrophage colony-stimulating factor, respectively. Expression of SCGF mRNA is restricted to myeloid cells and fibroblasts, suggesting that SCGF is a growth factor functioning within the hematopoietic microenvironment. SCGF could disclose some human-specific mechanisms as yet unidentified from studies on the murine hematopoietic system.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Identification of cytokine-inducible genes is imperative for determining the mechanisms of cytokine action. A cytokine-inducible gene, mrg1 [melanocyte-specific gene (msg1) related gene], was identified through mRNA differential display of interleukin (IL) 9-stimulated and unstimulated mouse helper T cells. In addition to IL-9, mrg1 can be induced by other cytokines and biological stimuli, including IL-1α, -2, -4, -6, and -11, granulocyte/macrophage colony-stimulating factor, interferon γ, platelet-derived growth factor, insulin, serum, and lipopolysaccharide in diverse cell types. The induction of mrg1 by these stimuli appears to be transient, with induction kinetics similar to other primary response genes, implicating its role in diverse biological processes. Deletion or point mutations of either the Box1 motif (binds Janus kinase 1) or the signal transducer and activator of transcription 3 binding site-containing region within the intracellular domain of the IL-9 receptor ligand binding subunit abolished or greatly reduced mrg1 induction by IL-9, suggesting that the Janus kinase/signal transducer and activator of transcription signaling pathway is required for mrg1 induction, at least in response to IL-9. Transfection of mrg1 cDNA into TS1, an IL-9-dependent mouse T cell line, converted these cells to IL-9-independent growth through a nonautocrine mechanism. Overexpression of mrg1 in Rat1 cells resulted in loss of cell contact inhibition, anchorage-independent growth in soft agar, and tumor formation in nude mice, demonstrating that mrg1 is a transforming gene. MRG1 is a transcriptional activator and may represent a founding member of an additional family of transcription factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

FLK-1/vascular endothelial growth factor receptor 2 (VEGFR-2) is one of the receptors for VEGF. In this study we examined the effect of cell density on activation of VEGFR-2. VEGF induces only very slight tyrosine phosphorylation of VEGFR-2 in confluent (95–100% confluent) pig aortic endothelial (PAE) cells. In contrast, robust VEGF-dependent tyrosine phosphorylation of VEGFR-2 was observed in cells plated in sparse culture conditions (60–65% confluent). A similar cell density-dependent phenomenon was observed in different endothelial cells but not in NIH-3T3 fibroblast cells expressing VEGFR-2. Stimulating cells with high concentrations of VEGF or replacing the extracellular domain of VEGFR-2 with that of the colony-stimulating factor 1 receptor did not alleviate the sensitivity of VEGFR-2 to cell density, indicating that the confluent cells were probably not secreting an antagonist to VEGF. Furthermore, in PAE cells, ectopically introduced platelet-derived growth factor α receptor could be activated at both high and low cell density conditions, indicating that the density effect was not universal for all receptor tyrosine kinases expressed in endothelial cells. In addition to lowering the density of cells, removing divalent cations from the medium of confluent cells potentiated VEGFR-2 phosphorylation in response to VEGF. These findings suggested that cell–cell contact may be playing a role in regulating the activation of VEGFR-2. To this end, pretreatment of confluent PAE cells with a neutralizing anti-cadherin-5 antibody potentiated the response of VEGFR-2 to VEGF. Our data demonstrate that endothelial cell density plays a critical role in regulating VEGFR-2 activity, and that the underlying mechanism appears to involve cadherin-5.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Transforming growth factor β (TGFβ) family ligands initiate a cascade of events capable of modulating cellular growth and differentiation. The receptors responsible for transducing these cellular signals are referred to as the type I and type II TGFβ receptors. Ligand binding to the type II receptor results in the transphosphorylation and activation of the type I receptor. This heteromeric complex then propagates the signal(s) to downstream effectors. There is presently little data concerning the fate of TGFβ receptors after ligand binding, with conflicting reports indicating no change or decreasing cell surface receptor numbers. To address the fate of ligand-activated receptors, we have used our previously characterized chimeric receptors consisting of the ligand binding domain from the granulocyte/macrophage colony-stimulating factor α or β receptor fused to the transmembrane and cytoplasmic domain of the type I or type II TGFβ receptor. This system not only provides the necessary sensitivity and specificity to address these types of questions but also permits the differentiation of endocytic responses to either homomeric or heteromeric intracellular TGFβ receptor oligomerization. Data are presented that show, within minutes of ligand binding, chimeric TGFβ receptors are internalized. However, although all the chimeric receptor combinations show similar internalization rates, receptor down-regulation occurs only after activation of heteromeric TGFβ receptors. These results indicate that effective receptor down-regulation requires cross-talk between the type I and type II TGFβ receptors and that TGFβ receptor heteromers and homomers show distinct trafficking behavior.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pre-B-cell growth-stimulating factor/stromal cell-derived factor 1 (PBSF/SDF-1) is a member of the CXC group of chemokines that is initially identified as a bone marrow stromal cell-derived factor and as a pre-B-cell stimulatory factor. Although most chemokines are thought to be inducible inflammatory mediators, PBSF/SDF-1 is essential for perinatal viability, B lymphopoiesis, bone marrow myelopoiesis, and cardiac ventricular septal formation, and it has chemotactic activities on resting lymphocytes and monocytes. In this paper, we have isolated a cDNA that encodes a seven transmembrane-spanning-domain receptor, designated pre-B-cell-derived chemokine receptor (PB-CKR) from a murine pre-B-cell clone, DW34. The deduced amino acid sequence has 90% identity with that of a HUMSTSR/fusin, a human immunodeficiency virus 1 (HIV-1) entry coreceptor. However, the second extracellular region has lower identity (67%) compared with HUMSTSR/fusin. PB-CKR is expressed during embryo genesis and in many organs and T cells of adult mice. Murine PBSF/SDF-1 induced an increase in intracellular free Ca2+ in DW34 cells and PB-CKR-transfected Chinese hamster ovary (CHO) cells, suggesting that PB-CKR is a functional receptor for murine PBSF/SDF-1. Murine PBSF/SDF-1 also induced Ca2+ influx in fusin-transfected CHO cells. On the other hand, considering previous results that HIV-1 does not enter murine T cells that expressed human CD4, PB-CKR may not support HIV-1 infection. Thus, PB-CKR will be an important tool for functional mapping of HIV-1 entry coreceptor fusin and for understanding the function of PBSF/SDF-1 further.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

IL-10-related T cell-derived inducible factor (IL-TIF or IL-21) is a new cytokine structurally related to IL-10 and originally identified in the mouse as a gene induced by IL-9 in T cells and mast cells. Here, we report the cloning of the human IL-TIF cDNA, which shares 79% amino acid identity with mouse IL-TIF and 25% identity with human IL-10. Recombinant human IL-TIF was found to activate signal transducer and activator of transcription factors-1 and -3 in several hepatoma cell lines. IL-TIF stimulation of HepG2 human hepatoma cells up-regulated the production of acute phase reactants such as serum amyloid A, α1-antichymotrypsin, and haptoglobin. Although IL-10 and IL-TIF have distinct activities, antibodies directed against the β chain of the IL-10 receptor blocked the induction of acute phase reactants by IL-TIF, indicating that this chain is a common component of the IL-10 and IL-TIF receptors. Similar acute phase reactant induction was observed in mouse liver upon IL-TIF injection, and IL-TIF expression was found to be rapidly increased after lipopolysaccharide (LPS) injection, suggesting that this cytokine contributes to the inflammatory response in vivo.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Transforming growth factor-βs (TGF-β) are multifunctional proteins capable of either stimulating or inhibiting mitosis, depending on the cell type. These diverse cellular responses are caused by stimulating a single receptor complex composed of type I and type II receptors. Using a chimeric receptor model where the granulocyte/monocyte colony-stimulating factor receptor ligand binding domains are fused to the transmembrane and cytoplasmic signaling domains of the TGF-β type I and II receptors, we wished to describe the role(s) of specific amino acid residues in regulating ligand-mediated endocytosis and signaling in fibroblasts and epithelial cells. Specific point mutations were introduced at Y182, T200, and Y249 of the type I receptor and K277 and P525 of the type II receptor. Mutation of either Y182 or Y249, residues within two putative consensus tyrosine-based internalization motifs, had no effect on endocytosis or signaling. This is in contrast to mutation of T200 to valine, which resulted in ablation of signaling in both cell types, while only abolishing receptor down-regulation in fibroblasts. Moreover, in the absence of ligand, both fibroblasts and epithelial cells constitutively internalize and recycle the TGF-β receptor complex back to the plasma membrane. The data indicate fundamental differences between mesenchymal and epithelial cells in endocytic sorting and suggest that ligand binding diverts heteromeric receptors from the default recycling pool to a pathway mediating receptor down-regulation and signaling.