31 resultados para (D)-SEQUENCES
Resumo:
Amino-terminal signal sequences target nascent secretory and membrane proteins to the endoplasmic reticulum for translocation. Subsequent interactions between the signal sequence and components of the translocation machinery at the endoplasmic reticulum are thought to be important for the productive engagement of the translocon by the ribosome-nascent chain complex. However, it is not clear whether all signal sequences carry out these posttargeting steps identically, or if there are differences in the interactions directed by one signal sequence versus another. In this study, we find substantial differences in the ability of signal sequences from different substrates to mediate closure of the ribosome–translocon junction early in translocation. We also show that these differences in some cases necessitate functional coordination between the signal sequence and mature domain for faithful translocation. Accordingly, the translocation of some proteins is sensitive to replacement of their signal sequences. In a particularly dramatic example, the topology of the prion protein was found to depend highly on the choice of signal sequence used to direct its translocation. Taken together, our results reveal an unanticipated degree of substrate-specific functionality encoded in N-terminal signal sequences.
Resumo:
The free energy difference between complexes of the restriction nuclease EcoRI with nonspecific DNA and with the enzyme's recognition sequence is linearly dependent on the water chemical potential of the solution, set using several very different solutes, ranging from glycine and glycerol to triethylene glycol and sucrose. This osmotic dependence indicates that the nonspecific complex sequesters some 110 waters more than the specific complex with the recognition sequence. The insensitivity of the difference in number of waters released to the solute identity further indicates that this water is sequestered in a space that is sterically inaccessible to solutes, most likely at the protein-DNA interface of the nonspecific complex. Calculations based on the structure of the specific complex suggest that the apposing DNA and protein surfaces in the nonspecific complex retain approximately a full hydration layer of water.
Resumo:
Phylogenetic analysis of ribosomal RNA sequences obtained from uncultivated organisms of a hot spring in Yellowstone National Park reveals several novel groups of Archaea, many of which diverged from the crenarchaeal line of descent prior to previously characterized members of that kingdom. Universal phylogenetic trees constructed with the addition of these sequences indicate monophyly of Archaea, with modest bootstrap support. The data also show a specific relationship between low-temperature marine Archaea and some hot spring Archaea. Two of the environmental sequences are enigmatic: depending upon the data set and analytical method used, these sequences branch deeply within the Crenarchaeota, below the bifurcation between Crenarchaeota and Euryarchaeota, or even as the sister group to Eukaryotes. If additional data confirm either of the latter two placements, then the organisms represented by these ribosomal RNA sequences would merit recognition as a new kingdom, provisionally named "Korarchaeota."
Resumo:
The condition termed 46,XY complete gonadal dysgenesis is characterized by a completely female phenotype and streak gonads. In contrast, subjects with 46,XY partial gonadal dysgenesis and those with embryonic testicular regression sequence usually present ambiguous genitalia and a mix of Müllerian and Wolffian structures. In 46,XY partial gonadal dysgenesis gonadal histology shows evidence of incomplete testis determination. In 46,XY embryonic testicular regression sequence there is lack of gonadal tissue on both sides. Various lines of evidence suggest that embryonic testicular regression sequence is a variant form of 46,XY gonadal dysgenesis. The sex-determining region Y chromosome gene (SRY) encodes sequences for the testis-determining factor. To date germ-line mutations in SRY have been reported in approximately 20% of subjects with 46,XY complete gonadal dysgenesis. However, no germ-line mutations of SRY have been reported in subjects with the partial forms. We studied 20 subjects who presented either 46,XY partial gonadal dysgenesis or 46,XY embryonic testicular regression sequence. We examined the SRY gene and the minimum region of Y-specific DNA known to confer a male phenotype. The SRY-open reading frame (ORF) was normal in all subjects. However a de novo interstitial deletion 3' to the SRY-ORF was found in one subject. Although it is possible that the deletion was unrelated to the subject's phenotype, we propose that the deletion was responsible for the abnormal gonadal development by diminishing expression of SRY. We suggest that the deletion resulted either in the loss of sequences necessary for normal SRY expression or in a position effect that altered SRY expression. This case provides further evidence that deletions of the Y chromosome outside the SRY-ORF can result in either complete or incomplete sex reversal.
Resumo:
Swiftlets are small insectivorous birds, many of which nest in caves and are known to echolocate. Due to a lack of distinguishing morphological characters, the taxonomy of swiftlets is primarily based on the presence or absence of echolocating ability, together with nest characters. To test the reliability of these behavioral characters, we constructed an independent phylogeny using cytochrome b mitochondrial DNA sequences from swiftlets and their relatives. This phylogeny is broadly consistent with the higher classification of swifts but does not support the monophyly of swiftlets. Echolocating swiftlets (Aerodramus) and the nonecholocating "giant swiftlet" (Hydrochous gigas) group together, but the remaining nonecholocating swiftlets belonging to Collocalia are not sister taxa to these swiftlets. While echolocation may be a synapomorphy of Aerodramus (perhaps secondarily lost in Hydrochous), no character of Aerodramus nests showed a statistically significant fit to the molecular phylogeny, indicating that nest characters are not phylogenetically reliable in this group.
Resumo:
Recombinational repair of double-stranded DNA gaps was investigated in Ustilago maydis. The experimental system was designed for analysis of repair of an autonomously replicating plasmid containing a cloned gene disabled by an internal deletion. It was discovered that crossing over rarely accompanied gap repair. The strong bias against crossing over was observed in three different genes regardless of gap size. These results indicate that gap repair in U. maydis is unlikely to proceed by the mechanism envisioned in the double-stranded break repair model of recombination, which was developed to account for recombination in Saccharomyces cerevisiae. Experiments aimed at exploring processing of DNA ends were performed to gain understanding of the mechanism responsible for the observed bias. A heterologous insert placed within a gap in the coding sequence of two different marker genes strongly inhibited repair if the DNA was cleaved at the promoter-proximal junction joining the insert and coding sequence but had little effect on repair if the DNA was cleaved at the promoter-distal junction. Gene conversion of plasmid restriction fragment length polymorphism markers engineered in sequences flanking both sides of a gap accompanied repair but was directionally biased. These results are interpreted to mean that the DNA ends flanking a gap are subject to different types of processing. A model featuring a single migrating D-loop is proposed to explain the bias in gap repair outcome based on the observed asymmetry in processing the DNA ends.
Resumo:
DNA sequences of neutral nuclear autosomal loci, compared across diverse human populations, provide a previously untapped perspective into the mode and tempo of the emergence of modern humans and a critical comparison with published clonally inherited mitochondrial DNA and Y chromosome measurements of human diversity. We obtained over 55 kilobases of sequence from three autosomal loci encompassing Alu repeats for representatives of diverse human populations as well as orthologous sequences for other hominoid species at one of these loci. Nucleotide diversity was exceedingly low. Most individuals and populations were identical. Only a single nucleotide difference distinguished presumed ancestral alleles from descendants. These results differ from those expected if alleles from divergent archaic populations were maintained through multiregional continuity. The observed virtual lack of sequence polymorphism is the signature of a recent single origin for modern humans, with general replacement of archaic populations.
Resumo:
If RNA editing could be rationally directed to mutated RNA sequences, genetic diseases caused by certain base substitutions could be treated. Here we use a synthetic complementary RNA oligonucleotide to direct the correction of a premature stop codon mutation in dystrophin RNA. The complementary RNA oligonucleotide was hybridized to a premature stop codon and the hybrid was treated with nuclear extracts containing the cellular enzyme double-stranded RNA adenosine deaminase. When the treated RNAs were translated in vitro, a dramatic increase in expression of a downstream luciferase coding region was observed. The cDNA sequence data are consistent with deamination of the adenosine in the UAG stop codon to inosine by double-stranded RNA adenosine deaminase. Injection of oligonucleotide-mRNA hybrids into Xenopus embryos also resulted in an increase in luciferase expression. These experiments demonstrate the principle of therapeutic RNA editing.
Resumo:
We have detected an endoribonucleolytic activity in human cell extracts that processes the Escherichia coli 9S RNA and outer membrane protein A (ompA) mRNA with the same specificity as RNase E from E. coli. The human enzyme was partially purified by ion-exchange chromatography, and the active fractions contained a protein that was detected with antibodies shown to recognize E. coli RNase E. RNA containing four repeats of the destabilizing motif AUUUA and RNA from the 3' untranslated region of human c-myc mRNA were also found to be cleaved by E. coli RNase E and its human counterpart in a fashion that may suggest a role of this activity in mammalian mRNA decay. It was also found that RNA containing more than one AUUUA motif was cleaved more efficiently than RNA with only one or a mutated motif. This finding of a eukaryotic endoribonucleolytic activity corresponding to RNase E indicates an evolutionary conservation of the components of mRNA degradation systems.
Resumo:
The internal transcribed spacers (ITS) of nuclear ribosomal DNA of 33 species of genus Paeonia (Paeoniaceae) were sequenced. In section Paeonia, different patterns of nucleotide additivity were detected in 14 diploid and tetraploid species at sites that are variable in the other 12 species of the section, suggesting that reticulate evolution has occurred. Phylogenetic relationships of species that do not show additivity, and thus ostensibly were not derived through hybridization, were reconstructed by parsimony analysis. The taxa presumably derived through reticulate evolution were then added to the phylogenetic tree according to additivity from putative parents. The study provides an example of successfully using ITS sequences to reconstruct reticulate evolution in plants and further demonstrates that the sequence data could be highly informative and accurate for detecting hybridization. Maintenance of parental sequences in the species of hybrid origin is likely due to slowing of concerted evolution caused by the long generation time of peonies. The partial and uneven homogenization of parental sequences displayed in nine species of putative hybrid origin may have resulted from gradients of gene conversion. The documented hybridizations may have occurred since the Pleistocene glaciations. The species of hybrid origin and their putative parents are now distantly allopatric. Reconstruction of reticulate evolution with sequence data, therefore, provides gene records for distributional histories of some of the parental species.
Resumo:
Open reading frames in the Plasmodium falciparum genome encode domains homologous to the adhesive domains of the P. falciparum EBA-175 erythrocyte-binding protein (eba-175 gene product) and those of the Plasmodium vivax and Plasmodium knowlesi Duffy antigen-binding proteins. These domains are referred to as Duffy binding-like (DBL), after the receptor that determines P. vivax invasion of Duffy blood group-positive human erythrocytes. Using oligonucleotide primers derived from short regions of conserved sequence, we have developed a reverse transcription-PCR method that amplifies sequences encoding the DBL domains of expressed genes. Products of these reverse transcription-PCR amplifications include sequences of single-copy genes (including eba-175) and variably transcribed genes that cross-hybridize to multiple regions of the genome. Restriction patterns of the multicopy genes show a high degree of polymorphism among different parasite lines, whereas single-copy genes are generally conserved. Characterization of the single-copy genes has identified a gene (ebl-1) that is related to eba-175 and is likely to be involved in erythrocyte invasion.
Resumo:
Five different clones encoding thioredoxin homologues were isolated from Arabidopsis thaliana cDNA libraries. On the basis of the sequences they encode divergent proteins, but all belong to the cytoplasmic thioredoxins h previously described in higher plants. The five proteins obtained by overexpressing the coding sequences in Escherichia coli present typical thioredoxin activities (NADP(+)-malate dehydrogenase activation and reduction by Arabidopsis thioredoxin reductase) despite the presence of a variant active site, Trp-Cys-Pro-Pro-Cys, in three proteins in place of the canonical Trp-Cys-Gly-Pro-Cys sequence described for thioredoxins in prokaryotes and eukaryotes. Southern blots show that each cDNA is encoded by a single gene but suggest the presence of additional related sequences in the Arabidopsis genome. This very complex diversity of thioredoxins h is probably common to all higher plants, since the Arabidopsis sequences appear to have diverged very early, at the beginning of plant speciation. This diversity allows the transduction of a redox signal into multiple pathways.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
To study the binding specificity of Src homology 3 (SH3) domains, we have screened a mouse embryonic expression library for peptide fragments that interact with them. Several clones were identified that express fragments of proteins which, through proline-rich binding sites, exhibit differential binding specificity to various SH3 domains. Src-SH3-specific binding uses a sequence of 7 aa of the consensus RPLPXXP, in which the N-terminal arginine is very important. The SH3 domains of the Src-related kinases Fyn, Lyn, and Hck bind to this sequence with the same affinity as that of the Src SH3. In contrast, a quite different proline-rich sequence from the Btk protein kinase binds to the Fyn, Lyn, and Hck SH3 domains, but not to the Src SH3. Specific binding of the Abl SH3 requires a longer, more proline-rich sequence but no arginine. One clone that binds to both Src and Abl SH3 domains through a common site exhibits reversed binding orientation, in that an arginine indispensable for binding to all tested SH3 domains occurs at the C terminus. Another clone contains overlapping yet distinct Src and Abl SH3 binding sites. Binding to the SH3 domains is mediated by a common PXXP amino acid sequence motif present on all ligands, and specificity comes about from other interactions, often ones involving arginine. The rules governing in vivo usage of particular sites by particular SH3 domains are not clear, but one binding orientation may be more specific than another.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.