221 resultados para Osteoclast regulatory protein


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Osmoregulated porin gene expression in Escherichia coli is controlled by the two-component regulatory system EnvZ and OmpR. EnvZ, the osmosensor, is an inner membrane protein and a histidine kinase. EnvZ phosphorylates OmpR, a cytoplasmic DNA-binding protein, on an aspartyl residue. Phospho-OmpR binds to the promoters of the porin genes to regulate the expression of ompF and ompC. We describe the use of limited proteolysis by trypsin and ion spray mass spectrometry to characterize phospho-OmpR and the conformational changes that occur upon phosphorylation. Our results are consistent with a two-domain structure for OmpR, an N-terminal phosphorylation domain joined to a C-terminal DNA-binding domain by a flexible linker region. In the presence of acetyl phosphate, OmpR is phosphorylated at only one site. Phosphorylation induces a conformational change that is transmitted to the C-terminal domain via the central linker. Previous genetic analysis identified a region in the C-terminal domain that is required for transcriptional activation. Our results indicate that this region is within a surface-exposed loop. We propose that this loop contacts the alpha subunit of RNA polymerase to activate transcription. Mass spectrometry also reveals an unusual dephosphorylated form of OmpR, the potential significance of which is discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Metazoan cyclin C was originally isolated by virtue of its ability to rescue Saccharomyces cerevisiae cells deficient in G1 cyclin function. This suggested that cyclin C might play a role in cell cycle control, but progress toward understanding the function of this cyclin has been hampered by the lack of information on a potential kinase partner. Here we report the identification of a human protein kinase, K35 [cyclin-dependent kinase 8 (CDK8)], that is likely to be a physiological partner of cyclin C. A specific interaction between K35 and cyclin C could be demonstrated after translation of CDKs and cyclins in vitro. Furthermore, cyclin C could be detected in K35 immunoprecipitates prepared from HeLa cells, indicating that the two proteins form a complex also in vivo. The K35-cyclin C complex is structurally related to SRB10-SRB11, a CDK-cyclin pair recently shown to be part of the RNA polymerase II holoenzyme of S. cerevisiae. Hence, we propose that human K35(CDK8)-cyclin C might be functionally associated with the mammalian transcription apparatus, perhaps involved in relaying growth-regulatory signals.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The bithorax complex (BX-C) of Drosophila, one of two complexes that act as master regulators of the body plan of the fly, has now been entirely sequenced and comprises approximately 315,000 bp, only 1.4% of which codes for protein. Analysis of this sequence reveals significantly overrepresented DNA motifs of unknown, as well as known, functions in the non-protein-coding portion of the sequence. The following types of motifs in that portion are analyzed: (i) concatamers of mono-, di-, and trinucleotides; (ii) tightly clustered hexanucleotides (spaced < or = 5 bases apart); (iii) direct and reverse repeats longer than 20 bp; and (iv) a number of motifs known from biochemical studies to play a role in the regulation of the BX-C. The hexanucleotide AGATAC is remarkably overrepresented and is surmised to play a role in chromosome pairing. The positions of sites of highly overrepresented motifs are plotted for those that occur at more than five sites in the sequence, when < 0.5 case is expected. Expected values are based on a third-order Markov chain, which is the optimal order for representing the BXCALL sequence.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The c-myb protooncogene encodes a highly conserved transcription factor that functions as both an activator and a repressor of transcription. The v-myb oncogenes of E26 leukemia virus and avian myeloblastosis virus encode proteins that are truncated at both the amino and the carboxyl terminus, deleting portions of the c-Myb DNA-binding and negative regulatory domains. This has led to speculation that the deleted regions contain important regulatory sequences. We previously reported that the 42-kDa mitogen-activated protein kinase (p42mapk) phosphorylates chicken and murine c-Myb at multiple sites in the negative regulatory domain in vitro, suggesting that phosphorylation might provide a mechanism to regulate c-Myb function. We now report that three tryptic phosphopeptides derived from in vitro phosphorylated c-Myb comigrate with three tryptic phosphopeptides derived from metabolically labeled c-Myb immunoprecipitated from murine erythroleukemia cells. At least two of these peptides are phosphorylated on serine-528. Replacement of serine-528 with alanine results in a 2- to 7-fold increase in the ability of c-Myb to transactivate a Myb-responsive promoter/reporter gene construct. These findings suggest that phosphorylation serves to regulate c-Myb activity and that loss of this phosphorylation site from the v-Myb proteins may contribute to their transforming potential.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To identify genes involved in the regulation of early mammalian development, we have developed a dominant-negative mutant basic-helix-loop-helix (bHLH) protein probe for interaction cloning and have isolated a member of the bHLH family of transcription factors, Meso1. Meso1-E2A heterodimers are capable of binding to oligonucleotide probes that contain a bHLH DNA recognition motif. In mouse embryos, Meso1 is expressed prior to MyoD1 family members. Meso1 expression is first detected at the neural plate stage of development in the paraxial mesoderm of the head and in presomitic mesodermal cells prior to their condensation into somites. Our findings suggest that Meso1 may be a key regulatory gene involved in the early events of vertebrate mesoderm differentiation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Calcium, a universal second messenger, regulates diverse cellular processes in eukaryotes. Ca2+ and Ca2+/calmodulin-regulated protein phosphorylation play a pivotal role in amplifying and diversifying the action of Ca(2+)-binding domain was cloned and characterized from lily. The cDNA clone contains an open reading frame coding for a protein of 520 amino acids. The predicted structure of CCaMK contains a catalytic domain followed by two regulatory domains, a calmodulin-binding domain and a visinin-like Ca(2+)-binding domain. The amino-terminal region of CCaMK contains all 11 conserved subdomains characteristic of serine/threonine protein kinases. The calmodulin-binding region of CCaMK has high homology (79%) to alpha subunit of mammalian Ca2+/calmodulin-dependent protein kinase. The calmodulin-binding region is fused to a neural visinin-like domain that contains three Ca(2+)-binding EF-hand motifs and a biotin-binding site. The Escherichia coli-expressed protein (approximately 56 kDa) binds calmodulin in a Ca(2+)-dependent manner. Furthermore, 45Ca-binding assays revealed that CCaMK directly binds Ca2+. The CCaMK gene is preferentially expressed in developing anthers. Southern blot analysis revealed that CCaMK is encoded by a single gene. The structural features of the gene suggest that it has multiple regulatory controls and could play a unique role in Ca2+ signaling in plants.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The cadherin-catenin complex is important for mediating homotypic, calcium-dependent cell-cell interactions in diverse tissue types. Although proteins of this complex have been identified, little is known about their interactions. Using a genetic assay in yeast and an in vitro protein-binding assay, we demonstrate that beta-catenin is the linker protein between E-cadherin and alpha-catenin and that E-cadherin does not bind directly to alpha-catenin. We show that a 25-amino acid sequence in the cytoplasmic domain of E-cadherin and the amino-terminal domain of alpha-catenin are independent binding sites for beta-catenin. In addition to beta-catenin and plakoglobin, another member of the armadillo family, p120 binds to E-cadherin. However, unlike beta-catenin, p120 does not bind alpha-catenin in vitro, although a complex of p120 and endogenous alpha-catenin could be immunoprecipitated from cell extracts. In vitro protein-binding assays using recombinant E-cadherin cytoplasmic domain and alpha-catenin revealed two catenin pools in cell lysates: an approximately 1000- to approximately 2000-kDa complex bound to E-cadherin and an approximately 220-kDa pool that did not contain E-cadherin. Only beta-catenin in the approximately 220-kDa pool bound exogenous E-cadherin. Delineation of these molecular linkages and the demonstration of separate pools of catenins in different cell lines provide a foundation for examining regulatory mechanisms involved in the assembly and function of the cadherin-catenin complex.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Stathmin is a ubiquitous, cytosolic 19-kDa protein, which is phosphorylated on up to four sites in response to many regulatory signals within cells. Its molecular characterization indicates a functional organization including an N-terminal regulatory domain that bears the phosphorylation sites, linked to a putative alpha-helical binding domain predicted to participate in coiled-coil, protein-protein interactions. We therefore proposed that stathmin may play the role of a relay integrating diverse intracellular regulatory pathways; its action on various target proteins would be a function of its combined phosphorylation state. To search for such target proteins, we used the two-hybrid screen in yeast, with stathmin as a "bait." We isolated and characterized four cDNAs encoding protein domains that interact with stathmin in vivo. One of the corresponding proteins was identified as BiP, a member of the hsp70 heat-shock protein family. Another is a previously unidentified, putative serine/threonine kinase, KIS, which might be regulated by stathmin or, more likely, be part of the kinases controlling its phosphorylation state. Finally, two clones code for subdomains of two proteins, CC1 and CC2, predicted to form alpha-helices participating in coiled-coil interacting structures. Their isolation by interaction screening further supports our model for the regulatory function of stathmin through coiled-coil interactions with diverse downstream targets via its presumed alpha-helical binding domain. The molecular and biological characterization of KIS, CC1, and CC2 proteins will give further insights into the molecular functions and mechanisms of action of stathmin as a relay of integrated intracellular regulatory pathways.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The pathogenic Gram-positive bacterium Streptococcus pyogenes (group A streptococcus) is the causative agent of numerous suppurative diseases of human skin. The M protein of S. pyogenes mediates the adherence of the bacterium to keratinocytes, the most numerous cell type in the epidermis. In this study, we have constructed and analyzed a series of mutant M proteins and have shown that the C repeat domain of the M molecule is responsible for cell recognition. The binding of factor H, a serum regulator of complement activation, to the C repeat region of M protein blocked bacterial adherence. Factor H is a member of a large family of complement regulatory proteins that share a homologous structural motif termed the short consensus repeat. Membrane cofactor protein (MCP), or CD46, is a short consensus repeat-containing protein found on the surface of keratinocytes, and purified MCP could competitively inhibit the adherence of S. pyogenes to these cells. Furthermore, the M protein was found to bind directly to MCP, whereas mutant M proteins that lacked the C repeat domain did not bind MCP, suggesting that recognition of MCP plays an important role in the ability of the streptococcus to adhere to keratinocytes.