Transcriptional activation of human adult alpha-globin genes by hypersensitive site-40 enhancer: function of nuclear factor-binding motifs occupied in erythroid cells.

The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element.

Transcription in archaea: similarity to that in eucarya.

We present homologies between archaeal and eucaryal DNA-dependent RNA polymerase (RNAP) subunits and transcription factors. The sequences of the Sulfolobus acidocaldarius subunits D, E, and N and alignments with eucaryal homologs are presented here. The similarities between archaeal transcription factors and their eucaryal homologs TFIIB and TBP have been established in other laboratories. The archaeal RNAP subunits H, K, and N, respectively, show high sequence similarity to ABC27, ABC23, and ABC10 beta (found in all three eucaryal RNAPs); subunit D, to AC40 (common to polymerase II and polymerase III) and B44 (polymerase II); and subunit L, to AC19 and B12.5. The similarity of subunit D and its eucaryal homologs to bacterial alpha is limited to the "alpha-motif," which is also present in subunit L and its eucaryal homologs. Genes encoding homologs of the related eucaryal RNAP subunits A12.2/B12.6 and also homologs of eucaryal transcription elongation factors of the TFIIS family have been detected in Sulfolobus acidocaldarius and Thermococcus celer. In archaea, the protein is not an RNAP subunit. Together with the sequence similarities between archaeal box A-containing and eucaryal TATA box-containing promoters, this shows that the archaeal and eucaryal transcription systems are truly homologous and that they differ structurally and functionally from the bacterial transcription machinery. In contrast, however, a number of genes for the archaeal transcription apparatus are organized in clusters resembling the clusters of transcription-associated genes in Bacteria.

Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley.

We describe a complete gene family encoding phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) in one particular plant species. In parsley (Petroselinum crispum), the PAL gene family comprises two closely related members, PAL1 and PAL2, whose TATA-proximal promoter and coding regions are almost identical, and two additional members, PAL3 and PAL4, with less similarity to one another and to the PAL1 and PAL2 genes. Using gene-specific probes derived from the 5' untranslated regions of PAL1/2, PAL3, and PAL4, we determined the respective mRNA levels in parsley leaves and cell cultures treated with UV light or fungal elicitor and in wounded leaves and roots. For comparison, the functionally closely related cinnamate 4-hydroxylase (C4H) and 4-coumarate:CoA ligase (4CL) mRNAs were measured in parallel. The results indicate various degrees of differential responsiveness of PAL4 relative to the other PAL gene family members, in contrast to a high degree of coordination in the overall expression of the PAL, C4H, and 4CL genes. The only significant sequence similarities shared by all four PAL gene promoters are a TATA-proximal set of three putative cis-acting elements (boxes P, A, and L). None of these elements alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness on a reporter gene in transient expression assays. The elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation, similar to the situation previously reported for 4CL.

Domains of transcription factor Sp1 required for synergistic activation with sterol regulatory element binding protein 1 of low density lipoprotein receptor promoter.

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

Delineation of a slow-twitch-myofiber-specific transcriptional element by using in vivo somatic gene transfer.

Contractile proteins are encoded by multigene families, most of whose members are differentially expressed in fast- versus slow-twitch myofibers. This fiber-type-specific gene regulation occurs by unknown mechanisms and does not occur within cultured myocytes. We have developed a transient, whole-animal assay using somatic gene transfer to study this phenomenon and have identified a fiber-type-specific regulatory element within the promoter region of a slow myofiber-specific gene. A plasmid-borne luciferase reporter gene fused to various muscle-specific contractile gene promoters was differentially expressed when injected into slow- versus fast-twitch rat muscle: the luciferase gene was preferentially expressed in slow muscle when fused to a slow troponin I promoter, and conversely, was preferentially expressed in fast muscle when fused to a fast troponin C promoter. In contrast, the luciferase gene was equally well expressed by both muscle types when fused to a nonfiber-type-specific skeletal actin promoter. Deletion analysis of the troponin I promoter region revealed that a 157-bp enhancer conferred slow-muscle-preferential activity upon a minimal thymidine kinase promoter. Transgenic analysis confirmed the role of this enhancer in restricting gene expression to slow-twitch myofibers. Hence, somatic gene transfer may be used to rapidly define elements that direct myofiber-type-specific gene expression prior to the generation of transgenic mice.

Position-dependent variegation of globin transgene expression in mice.

Expression of genes in eukaryotes has commonly been analyzed in a whole tissue, and levels of expression have been interpreted as the result of equivalent rates of transcription in every cell. We have produced transgenic mouse lines that express beta-galactosidase under the control of globin promoters linked to the major tissue-specific regulatory element of the alpha-globin locus, which permits the analysis of transgene expression in individual red blood cells. We find that expression of the transgene within all mouse lines is heterocellular. Individual cells either do not express the transgene at all or express it at a level characteristic of that line. The number of beta-galactosidase-expressing cells varies greatly between different lines of transgenic mice at any defined stage of development, but within a transgenic line, individual mice have strikingly similar numbers of expressing cells. This suggests that the degree of heterocellular expression is determined by the site of integration, as is seen in position-effect variegation.

Heat shock protein hsp90 regulates dioxin receptor function in vivo.

The dioxin (aryl hydrocarbon) receptor is a ligand-dependent basic helix-loop-helix (bHLH) factor that binds to xenobiotic response elements of target promoters upon heterodimerization with the bHLH partner factor Arnt. Here we have replaced the bHLH motif of the dioxin receptor with a heterologous DNA-binding domain to create fusion proteins that mediate ligand-dependent transcriptional enhancement in yeast (Saccharomyces cerevisiae). Previously, our experiments indicated that the ligand-free dioxin receptor is stably associated with the 90-kDa heat shock protein, hsp90. To investigate the role of hsp90 in dioxin signaling we have studied receptor function in a yeast strain where hsp90 expression can be down-regulated to about 5% relative to wild-type levels. At low levels of hsp90, ligand-dependent activation of the chimeric dioxin receptor construct was almost completely inhibited, whereas the activity of a similar chimeric construct containing the structurally related Arnt factor was not affected. Moreover, a chimeric dioxin receptor construct lacking the central ligand- and hsp90-binding region of the receptor showed constitutive transcriptional activity in yeast that was not impaired upon down-regulation of hsp90 expression levels. Thus, these data suggest that hsp90 is a critical determinant of conditional regulation of dioxin receptor function in vivo via the ligand-binding domain.

General requirement for RNA polymerase II holoenzymes in vivo.

Yeast RNA polymerase II holoenzymes have been described that consist of RNA polymerase II, a subset of general transcription factors, and nine SRB regulatory proteins. The feature that distinguishes the RNA polymerase II holoenzymes from other forms of RNA polymerase II in the cell is their tight association with SRB proteins. We investigated the fraction of genes that require SRB proteins in vivo by examining the effect of temperature-sensitive mutations in SRB genes on transcription by RNA polymerase II. Upon transfer to the restrictive temperature, there is a rapid and general shutdown of mRNA synthesis in srb mutant cells. These data, combined with the observation that essentially all of the SRB protein in cells is tightly associated with RNA polymerase II molecules, argue that SRB-containing holoenzymes are the form of RNA polymerase II recruited to most promoters in the cell.

Repression by SSN6-TUP1 is directed by MIG1, a repressor/activator protein.

The SSN6-TUP1 protein complex represses transcription of diversely regulated genes in the yeast Saccharomyces cerevisiae. Here we present evidence that MIG1, a zinc-finger protein in the EGR1/Zif268 family, recruits SSN6-TUP1 to glucose-repressed promoters. DNA-bound LexA-MIG1 represses transcription of a target gene in glucose-grown cells, and repression requires SSN6 and TUP1. We also show that MIG1 and SSN6 fusion proteins interact in the two-hybrid system. Unexpectedly, we found that LexA-MIG1 activates transcription strongly in an ssn6 mutant and weakly in a tup1 mutant. Finally, LexA-MIG1 does not repress transcription in glucose-deprived cells, and MIG1 is differentially phosphorylated in response to glucose availability. We suggest a role for phosphorylation in regulating repression.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Promoter architecture in the flagellar regulon of Bacillus subtilis: high-level expression of flagellin by the sigma D RNA polymerase requires an upstream promoter element.

Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.