Gene for the catalytic subunit of the human DNA-activated protein kinase maps to the site of the XRCC7 gene on chromosome 8.

The DNA-activated serine/threonine protein kinase (DNA-PK) is composed of a large (approximately 460 kDa) catalytic polypeptide (DNA-PKcs) and Ku, a heterodimeric DNA-binding component (p70/p80) that targets DNA-PKcs to DNA. A 41-kbp segment of the DNA-PKcs gene was isolated, and a 7902-bp segment was sequenced. The sequence contains a polymorphic Pvu II restriction enzyme site, and comparing the sequence with that of the cDNA revealed the positions of nine exons. The DNA-PKcs gene was mapped to band q11 of chromosome 8 by in situ hybridization. This location is coincident with that of XRCC7, the gene that complements the DNA double-strand break repair and V(D)J recombination defects (where V is variable, D is diversity, and J is joining) of hamster V3 and murine severe combined immunodeficient (scid) cells.

Basal expression of the cystic fibrosis transmembrane conductance regulator gene is dependent on protein kinase A activity.

The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.

The su(Hw) protein bound to gypsy sequences in one chromosome can repress enhancer-promoter interactions in the paired gene located in the other homolog.

The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.

A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity.

We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.

The ATX1 gene of Saccharomyces cerevisiae encodes a small metal homeostasis factor that protects cells against reactive oxygen toxicity.

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. Here we describe the isolation and characterization of another gene in the yeast Saccharomyces cerevisiae that plays a critical role in detoxification of reactive oxygen species. This gene, named ATX1, was originally isolated by its ability to suppress oxygen toxicity in yeast lacking SOD. ATX1 encodes a 8.2-kDa polypeptide exhibiting significant similarity and identity to various bacterial metal transporters. Potential ATX1 homologues were also identified in multicellular eukaryotes, including the plants Arabidopsis thaliana and Oryza sativa and the nematode Caenorhabditis elegans. In yeast cells, ATX1 evidently acts in the transport and/or partitioning of copper, and this role in copper homeostasis appears to be directly relevant to the ATX1 suppression of oxygen toxicity: ATX1 was incapable of compensating for SOD when cells were depleted of exogenous copper. Strains containing a deletion in the chromosomal ATX1 locus were generated. Loss of ATX1 function rendered both mutant and wild-type SOD strains hypersensitive toward paraquat (a generator of superoxide anion) and was also associated with an increased sensitivity toward hydrogen peroxide. Hence, ATX1 protects cells against the toxicity of both superoxide anion and hydrogen peroxide.

Identification of the gene (SSU71/TFG1) encoding the largest subunit of transcription factor TFIIF as a suppressor of a TFIIB mutation in Saccharomyces cerevisiae.

Mutations in the Saccharomyces cerevisiae SSU71 gene were isolated as suppressors of a transcription factor TFIIB defect that confers both a cold-sensitive growth defect and a downstream shift in transcription start-site selection at the cyc1 locus. The ssu71-1 suppressor not only suppresses the conditional phenotype but also restores the normal pattern of transcription initiation at cyc1. In addition, the ssu71-1 suppressor confers a heat-sensitive phenotype that is dependent upon the presence of the defective form of TFIIB. Molecular and genetic analysis of the cloned SSU71 gene demonstrated that SSU71 is a single-copy essential gene encoding a highly charged protein with a molecular mass of 82,194 daltons. Comparison of the deduced Ssu71 amino acid sequence with the protein data banks revealed significant similarity to RAP74, the larger subunit of the human general transcription factor TFIIF. Moreover, Ssu71 is identical to p105, a component of yeast TFIIF. Taken together, these data demonstrate a functional interaction between TFIIB and the large subunit of TFIIF and that this interaction can affect start-site selection in vivo.

Mutation spectrum of the gene encoding the beta subunit of rod phosphodiesterase among patients with autosomal recessive retinitis pigmentosa.

Mutations in the gene encoding the beta subunit of rod cGMP phosphodiesterase are known causes of photoreceptor degeneration in two animal models of retinitis pigmentosa, the rd (retinal degeneration) mouse and the Irish setter dog with rod/cone dysplasia. Here we report a screen of 92 unrelated patients with autosomal recessive retinitis pigmentosa for defects in the human homologue of this gene. We identified seven different mutations that cosegregate with the disease. They were found among four patients with each patient heterozygously carrying two mutations. All of these mutations are predicted to affect the putative catalytic domain, probably leading to a decrease in phosphodiesterase activity and an increase in cGMP levels within rod photoreceptors. Mutations in the gene encoding the beta subunit of rod phosphodiesterase are the most common identified cause of autosomal recessive retinitis pigmentosa, accounting for approximately 4% of cases in North America.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.