The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative sigma factor (sigma E).

Chronic infection by alginate-producing (mucoid) Pseudomonas aeruginosa is the leading cause of mortality among cystic fibrosis (CF) patients. During the course of sustained infection, the production of an alginate capsule protects the bacteria and allows them to persist in the CF lung. One of the key regulators of alginate synthesis is the algT (algU) gene encoding a putative alternative sigma factor (sigma E). AlgT was hyperproduced and purified from Escherichia coli. The N-terminal sequence of the purified protein matched perfectly with that predicted from the DNA sequence. The purified protein, in the presence of E. coli RNA polymerase core enzyme, was able to initiate transcription of an algT promoter. Deletion of the -35 region of this promoter abolished this activity in vitro as well as in vivo. These data indicate that the algT gene encodes a sigma factor that is autoregulatory.

cAMP- and rapamycin-sensitive regulation of the association of eukaryotic initiation factor 4E and the translational regulator PHAS-I in aortic smooth muscle cells.

Incubating rat aortic smooth muscle cells with either platelet-derived growth factor BB (PDGF) or insulin-like growth factor I (IGF-I) increased the phosphorylation of PHAS-I, an inhibitor of the mRNA cap binding protein, eukaryotic initiation factor (eIF) 4E. Phosphorylation of PHAS-I promoted dissociation of the PHAS-I-eIF-4E complex, an effect that could partly explain the stimulation of protein synthesis by the two growth factors. Increasing cAMP with forskolin decreased PHAS-I phosphorylation and markedly increased the amount of eIF-4E bound to PHAS-I, effects consistent with an action of cAMP to inhibit protein synthesis. Both PDGF and IGF-I activated p70S6K, but only PDGF increased mitogen-activated protein kinase activity. Forskolin decreased by 50% the effect of PDGF on increasing p70S6K, and forskolin abolished the effect of IGF-I on the kinase. The effects of PDGF and IGF-I on increasing PHAS-I phosphorylation, on dissociating the PHAS-I-eIF-4E complex, and on increasing p70S6K were abolished by rapamycin. The results indicate that IGF-I and PDGF increase PHAS-I phosphorylation in smooth muscle cells by the same rapamycin-sensitive pathway that leads to activation of p70S6K.

Insulin-like growth factor I treatment reduces demyelination and up-regulates gene expression of myelin-related proteins in experimental autoimmune encephalomyelitis.

To compare effects of insulin-like growth factor I (IGF-I) and placebo treatment on lesions that resemble those seen during active demyelination in multiple sclerosis, we induced experimental autoimmune encephalomyelitis in Lewis rats with an emulsion containing guinea pig spinal cord and Freund's adjuvant. On day 12-13, pairs of rats with the same degree of weakness were given either IGF-I or placebo intravenously twice daily for 8 days. After 8 days of placebo or IGF-I (200 micrograms/day or 1 mg/day) treatment, the spinal cord lesions were studied by in situ hybridization and with immunocytochemical and morphological methods. IGF-I produced significant reductions in numbers and areas of demyelinating lesions. These lesions contained axons surrounded by regenerating myelin segments instead of demyelinated axons seen in the placebo-treated rats. Relative mRNA levels for myelin basic protein, proteolipid protein (PLP), and 2',3'-cyclic nucleotide 3'-phosphodiesterase in lesions of IGF-I-treated rats were significantly higher than they were in placebo-treated rats. PLP mRNA-containing oligodendroglia also were more numerous and relative PLP mRNA levels per oligodendrocyte were higher in lesions of IGF-I-treated rats. Finally, a significantly higher proportion of proliferating cells were oligodendroglia-like cells in lesions of IGF-I-treated rats. We think that IGF-I effects on oligodendrocytes, myelin protein synthesis, and myelin regeneration reduced lesion severity and promoted clinical recovery in this experimental autoimmune encephalomyelitis model. These IGF-I actions may also benefit patients with multiple sclerosis.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Membrane cofactor protein (CD46) is a keratinocyte receptor for the M protein of the group A streptococcus.

The pathogenic Gram-positive bacterium Streptococcus pyogenes (group A streptococcus) is the causative agent of numerous suppurative diseases of human skin. The M protein of S. pyogenes mediates the adherence of the bacterium to keratinocytes, the most numerous cell type in the epidermis. In this study, we have constructed and analyzed a series of mutant M proteins and have shown that the C repeat domain of the M molecule is responsible for cell recognition. The binding of factor H, a serum regulator of complement activation, to the C repeat region of M protein blocked bacterial adherence. Factor H is a member of a large family of complement regulatory proteins that share a homologous structural motif termed the short consensus repeat. Membrane cofactor protein (MCP), or CD46, is a short consensus repeat-containing protein found on the surface of keratinocytes, and purified MCP could competitively inhibit the adherence of S. pyogenes to these cells. Furthermore, the M protein was found to bind directly to MCP, whereas mutant M proteins that lacked the C repeat domain did not bind MCP, suggesting that recognition of MCP plays an important role in the ability of the streptococcus to adhere to keratinocytes.