33 resultados para interleukin 5


Relevância:

100.00% 100.00%

Publicador:

Resumo:

T helper (Th) cells can be categorized according to their cytokine expression. The differential induction of Th cells expressing Th1 and/or Th2 cytokines is key to the regulation of both protective and pathological immune responses. Cytokines are expressed transiently and there is a lack of stably expressed surface molecules, significant for functionally different types of Th cells. Such molecules are of utmost importance for the analysis and selective functional modulation of Th subsets and will provide new therapeutic strategies for the treatment of allergic or autoimmune diseases. To this end, we have identified potential target genes preferentially expressed in Th2 cells, expressing interleukin (IL)-4, IL-5, and/or IL-10, but not interferon-γ. One such gene, T1/ST2, is expressed stably on both Th2 clones and Th2-polarized cells activated in vivo or in vitro. T1/ST2 expression is independent of induction by IL-4, IL-5, or IL-10. T1/ST2 plays a critical role in Th2 effector function. Administration of either a mAb against T1/ST2 or recombinant T1/ST2 fusion protein attenuates eosinophilic inflammation of the airways and suppresses IL-4 and IL-5 production in vivo following adoptive transfer of Th2 cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

CD38 ligation on mouse B cells by CS/2, an anti-mouse CD38 mAb, induced proliferation, interleukin 5 (IL-5) receptor α chain expression, and tyrosine phosphorylation of Bruton tyrosine kinase (Btk) from wild-type, but not from X chromosome-linked, immunodeficient mice. B cells from fyn-deficient (Fyn−/−) and lyn-deficient (Lyn−/−) mice showed an impaired response to mAb CS/2 for proliferation and IL-5 receptor α chain expression, and B cells from fyn/lyn double-deficient (Fyn/Lyn−/−) mice did not respond at all to mAb CS/2. The Btk activation by CD38 ligation was observed in B cells from Fyn−/− mice, and it was severely impaired in B cells from Lyn−/− and Fyn/Lyn−/− mice. CD38 expression on B cells from three mutant strains was comparable to that on control B cells. We infer from these results that both Fyn and Lyn are required and that their signals are synergistic for B cell triggering after CD38 ligation. Lyn is upstream of Btk activation in the CD38 signaling. Stimulation of B cells with IL-5 together with CD38 ligation induces not only IgM but also IgG1 secretion. Analysis of the synergistic effects of IL-5 and CD38 ligation on IgG1 secretion revealed the impaired IgG1 secretion of B cells from Lyn−/− and Fyn/Lyn−/− mice. These data imply that Lyn is involved in B cell triggering by CD38 ligation plus IL-5 for isotype switching.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Normal mouse marrow cells were stimulated by stem cell factor (SCF) to form dispersed or multicentric blast colonies containing progenitor cells committed to various hematopoietic lineages. Combination of the eosinophil-specific regulator interleukin 5 with SCF increased the frequency of colonies containing eosinophil-committed progenitor cells with multicentric but not dispersed blast colonies. Combination of thrombopoietin with SCF increased the frequency of colonies containing megakaryocyte-committed progenitor cells with both types of blast colony. Neither interleukin 5 nor thrombopoietin significantly altered the number or total cell content of blast colonies or progenitor cell numbers in blast colonies from those stimulated by SCF alone. No correlation was observed between total progenitor cell content and the presence or absence of either eosinophil or megakaryocyte progenitors in either type of blast colony. The data argue against a random process as being responsible for the formation of particular committed progenitor cells or the possibility that lineage-specific regulators merely enhance survival of such committed progenitor cells formed in developing blast colonies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A murine model for antigen-induced bronchial hyperreactivity (BHR) and airway eosinophilia, two hallmarks of asthma, was developed using ovalbumin-immunized mice, which produce large amounts of IgE (named BP2, "Bons Producteurs 2," for High Line of Selection 2). A single intranasal ovalbumin challenge failed to modify the bronchial responses, despite the intense eosinophil recruitment into the bronchoalveolar lavage fluid and airways. When mice were challenged twice a day for 2 days or once a day for 10 days, BHR in response to i.v. 5-hydroxytryptamine or to inhaled methacholine was induced in BP2 mice but not in BALB/c mice. Histological examination showed that eosinophils reached the respiratory epithelium after multiple ovalbumin challenges in BP2 mice but remained in the bronchial submucosa in BALB/c mice. Total IgE titers in serum were augmented significantly with immunization in both strains, but much more so in BP2 mice. Interleukin 5 (IL-5) titers in serum and bronchoalveolar lavage fluid of BP2 mice were augmented by the antigenic provocation, and a specific anti-IL5 neutralizing antibody suppressed altogether airway eosinophilia and BHR, indicating a participation of IL-5 in its development. Our results indicate that the recruitment of eosinophils to the airways alone does not induce BHR in mice and that the selective effect on BP2 mice is related to their increased IgE titers associated with antigen-driven eosinophil migration to the epithelium, following formation and secretion of IL-5.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mouse CD38 has been implicated in the regulation of both B-cell proliferation and protection of B cells from irradiation-induced apoptosis. CD38 ligation on B cells by CS/2, an anti-mouse CD38 monoclonal antibody, induced proliferation, IgM secretion, and tyrosine phosphorylation of Bruton tyrosine kinase in B cells from wild-type mice. B cells from X chromosome-linked immunodeficient mice did not respond at all to anti-CD38 antibody, although CD38 expression on these B cells was comparable to that on wild-type B cells. We infer from these results that Bruton tyrosine kinase activation is involved in B-cell triggering after cross-linkage of CD38. Analysis of the synergistic effects of various cytokines with CD38 ligation on B-cell activation revealed that interleukin 5 (IL-5) showed the most potent effect on B-cell proliferation, Blimp1 gene expression, and IgM production. These synergistic effects were not seen with B cells from X chromosome-linked immunodeficient mice. Flow cytometry analysis revealed that CD38 ligation increased surface expression of the IL-5-receptor alpha chain on B cells. These data indicate that CD38 ligation increases IL-5 receptor alpha expression and synergizes with IL-5 to enhance Blimp1 expression and IgM synthesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cassette mutagenesis was used to identify side chains in human interleukin 5 (hIL-5) that mediate binding to hIL-5 receptor alpha chain (hIL-5R alpha). A series of single alanine substitutions was introduced into a stretch of residues in the C-terminal region, including helix D, which previously had been implicated in receptor alpha chain recognition and which is aligned on the IL-5 surface so as to allow the topography of receptor binding residues to be examined. hIL-5 and single site mutants were expressed in COS cells, their interactions with hIL-5R alpha were measured by a sandwich surface plasmon resonance biosensor method, and their biological activities were measured by an IL-5-dependent cell proliferation assay. A pattern of mutagenesis effects was observed, with greatest impact near the interface between the two four-helix bundles of IL-5, in particular at residues Glu-110 and Trp-111, and least at the distal ends of the D helices. This pattern suggests the possibility that residues near the interface of the two four-helix bundles in hIL-5 comprise a central patch or hot spot, which constitutes an energetically important alpha chain recognition site. This hypothesis suggests a structural explanation for the 1:1 stoichiometry observed for the complex of hIL-5 with hIL-5R alpha.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A detailed structure-function analysis of human interleukin 5 (hIL5) has been performed. The hIL5 receptor is composed of two different polypeptide chains, the alpha and beta subunits. The alpha subunit alone is sufficient for ligand binding, but association with the beta subunit leads to a 2- to 3-fold increase in binding affinity. The beta chain is shared with the receptors for IL3 and granulocyte/macrophage-colony-stimulating factor--hence the descriptor beta C (C for common). All hIL5 mutants were analyzed in a solid-phase binding assay for hIL5R alpha interaction and in a proliferation assay using IL5-dependent cell lines for receptor-complex activation. Most residues affecting binding to the receptor alpha subunit were clustered in a loop connecting beta-strand 1 and helix B (mutants H38A, K39A, and H41A), in beta-strand 2 (E89A and R91A; weaker effect for E90A) and close to the C terminus (T109A, E110A, W111S, and I112A). Mutations at one position, E13 (Glu13), caused a reduced activation of the hIL5 receptor complex. In the case of E13Q, only 0.05% bioactivity was detected on a hIL5-responsive subclone of the mouse promyelocytic cell line FDC-P1. Moreover, on hIL5-responsive TF1 cells, the same mutant was completely inactive and proved to have antagonistic properties. Interactions of this mutant with both receptor subunits were nevertheless indistinguishable from those of nonmutated hIL5 by crosslinking and Scatchard plot analysis of transfected COS-1 cells.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Mutation of Bruton’s tyrosine kinase (Btk) impairs B cell maturation and function and results in a clinical phenotype of X-linked agammaglobulinemia. Activation of Btk correlates with an increase in the phosphorylation of two regulatory Btk tyrosine residues. Y551 (site 1) within the Src homology type 1 (SH1) domain is transphosphorylated by the Src family tyrosine kinases. Y223 (site 2) is an autophosphorylation site within the Btk SH3 domain. Polyclonal, phosphopeptide-specific antibodies were developed to evaluate the phosphorylation of Btk sites 1 and 2. Crosslinking of the B cell antigen receptor (BCR) or the mast cell Fcɛ receptor, or interleukin 5 receptor stimulation each induced rapid phosphorylation at Btk sites 1 and 2 in a tightly coupled manner. Btk molecules were singly and doubly tyrosine-phosphorylated. Phosphorylated Btk comprised only a small fraction (≤5%) of the total pool of Btk molecules in the BCR-activated B cells. Increased dosage of Lyn in B cells augmented BCR-induced phosphorylation at both sites. Kinetic analysis supports a sequential activation mechanism in which individual Btk molecules undergo serial transphosphorylation (site 1) then autophosphorylation (site 2), followed by successive dephosphorylation of site 1 then site 2. The phosphorylation of conserved tyrosine residues within structurally related Tec family kinases is likely to regulate their activation.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Differential activation of CD4+ T-cell precursors in vivo leads to the development of effectors with unique patterns of lymphokine secretion. To investigate whether the differential pattern of lymphokine secretion is influenced by factors associated with either the display and/or recognition of the ligand, we have used a set of ligands with various class II binding affinities but unchanged T-cell specificity. The ligand that exhibited approximately 10,000-fold higher binding to I-Au considerably increased the frequency of interferon gamma-producing but not interleukin (IL) 4- or IL-5-secreting cells in vivo. Using an established ligand-specific, CD4+ T-cell clone secreting only IL-4, we also demonstrated that stimulation with the highest affinity ligand resulted in interferon gamma production in vitro. In contrast, ligands that demonstrated relatively lower class II binding induced only IL-4 secretion. These data suggest that the major histocompatibility complex binding affinity of antigenic determinants, leading to differential interactions at the T cell-antigen-presenting cell interface, can be crucial for the differential development of cytokine patterns in T cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

To explore the possible involvement of STAT factors ("signal transducers and activators of transcription") in the interleukin 2 receptor (IL-2R) signaling cascade, murine HT-2 cells expressing chimeric receptors composed of the extracellular domain of the erythropoietin receptor fused to the cytoplasmic domains of the IL-2R beta or -gamma c chains were prepared. Erythropoietin or IL-2 activation of these cells resulted in rapid nuclear expression of a DNA-binding activity that reacted with select STAT response elements. Based on reactivity with specific anti-STAT antibodies, this DNA-binding activity was identified as a murine homologue of STAT-5. Induction of nuclear expression of this STAT-5-like factor was blocked by the addition of herbimycin A, a tyrosine kinase inhibitor, but not by rapamycin, an immunophilin-binding antagonist of IL-2-induced proliferation. The IL-2R beta chain appeared critical for IL-2-induced activation of STAT-5, since a mutant beta chain lacking all cytoplasmic tyrosine residues was incapable of inducing this DNA binding. In contrast, a gamma c mutant lacking all of its cytoplasmic tyrosine residues proved fully competent for the induction of STAT-5. Physical binding of STAT-5 to functionally important tyrosine residues within IL-2R beta was supported by the finding that phosphorylated, but not nonphosphorylated, peptides corresponding to sequences spanning Y392 and Y510 of the IL-2R beta tail specifically inhibited STAT-5 DNA binding.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

It is widely accepted that interleukin-1β (IL-1β), a cytokine produced not only by immune cells but also by glial cells and certain neurons influences brain functions during infectious and inflammatory processes. It is still unclear, however, whether IL-1 production is triggered under nonpathological conditions during activation of a discrete neuronal population and whether this production has functional implications. Here, we show in vivo and in vitro that IL-1β gene expression is substantially increased during long-term potentiation of synaptic transmission, a process considered to underlie certain forms of learning and memory. The increase in gene expression was long lasting, specific to potentiation, and could be prevented by blockade of potentiation with the N-methyl-d-aspartate (NMDA) receptor antagonist, (±)-2-amino-5-phosphonopentanoic acid (AP-5). Furthermore, blockade of IL-1 receptors by the specific interleukin-1 receptor antagonist (IL-1ra) resulted in a reversible impairment of long-term potentiation maintenance without affecting its induction. These results show for the first time that the production of biologically significant amounts of IL-1β in the brain can be induced by a sustained increase in the activity of a discrete population of neurons and suggest a physiological involvement of this cytokine in synaptic plasticity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The cytokine interleukin (IL) 18 (formerly interferon γ-inducing factor) induces the T helper type 1 response. In the present studies, IL-18 increased HIV type 1 (HIV-1) production from 5- to 30-fold in the chronically infected U1 monocytic cell line. Inhibition of tumor necrosis factor (TNF) activity by the addition of TNF-binding protein reduced IL-18-stimulated HIV-1 production by 48%. In the same cultures, IL-18-induced IL-8 was inhibited by 96%. Also, a neutralizing anti-IL-6 mAb reduced IL-18-induced HIV-1 by 63%. Stimulation of U1 cells with IL-18 resulted in increased production of IL-6, and exogenous IL-6 added to U1 cells increased HIV-1 production 4-fold over control. A specific inhibitor of the p38 mitogen-activated protein kinase reduced IL-18-induced HIV-1 by 73%, and a 50% inhibition was observed at 0.05 μM. In the same cultures, IL-8 was inhibited by 87%. By gel-shift and supershift analyses, increased binding activity of the transcription factor NF-κB was measured in nuclear extracts from U1 cells 1 h after exposure to IL-18. These results demonstrate induction of HIV-1 by IL-18 in a monocyte target associated with an intermediate role for TNF and IL-6, activation of p38 mitogen-activated protein kinase, and nuclear translocation of NF-κB.