57 resultados para Human Element


Relevância:

40.00% 40.00%

Publicador:

Resumo:

T cell receptor (TCR) α and δ gene segments are organized within a single genetic locus but are differentially regulated during T cell development. An enhancer-blocking element (BEAD-1, for blocking element alpha/delta 1) was localized to a 2.0-kb region 3′ of TCR δ gene segments and 5′ of TCR α joining gene segments within this locus. BEAD-1 blocked the ability of the TCR δ enhancer (Eδ) to activate a promoter when located between the two in a chromatin-integrated construct. We propose that BEAD-1 functions as a boundary that separates the TCR α/δ locus into distinct regulatory domains controlled by Eδ and the TCR α enhancer, and that it prevents Eδ from opening the chromatin of the TCR α joining gene segments for VDJ recombination at an early stage of T cell development.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Twenty-four base pairs of the human antioxidant response element (hARE) are required for high basal transcription of the NAD(P)H:quinone oxidoreductase1 (NQO1) gene and its induction in response to xenobiotics and antioxidants. hARE is a unique cis-element that contains one perfect and one imperfect AP1 element arranged as inverse repeats separated by 3 bp, followed by a “GC” box. We report here that Jun, Fos, Fra, and Nrf nuclear transcription factors bind to the hARE. Overexpression of cDNA derived combinations of the nuclear proteins Jun and Fos or Jun and Fra1 repressed hARE-mediated chloramphenicol acetyltransferase (CAT) gene expression in transfected human hepatoblastoma (Hep-G2) cells. Further experiments suggested that this repression was due to overexpression of c-Fos and Fra1, but not due to Jun proteins. The Jun (c-Jun, Jun-B, and Jun-D) proteins in all the possible combinations were more or less ineffective in repression or upregulation of hARE-mediated gene expression. Interestingly, overexpression of Nrf1 and Nrf2 individually in Hep-G2 and monkey kidney (COS1) cells significantly increased CAT gene expression from reporter plasmid hARE-thymidine kinase-CAT in transfected cells that were inducible by β-naphthoflavone and tert-butyl hydroquinone. These results indicated that hARE-mediated expression of the NQO1 gene and its induction by xenobiotics and antioxidants are mediated by Nrf1 and Nrf2. The hARE-mediated basal expression, however, is repressed by overexpression of c-Fos and Fra1.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The regulated expression of type A γ-aminobutyric acid receptor (GABAAR) subunit genes is postulated to play a role in neuronal maturation, synaptogenesis, and predisposition to neurological disease. Increases in GABA levels and changes in GABAAR subunit gene expression, including decreased β1 mRNA levels, have been observed in animal models of epilepsy. Persistent exposure to GABA down-regulates GABAAR number in primary cultures of neocortical neurons, but the regulatory mechanisms remain unknown. Here, we report the identification of a TATA-less minimal promoter of 296 bp for the human GABAAR β1 subunit gene that is neuron specific and autologously down-regulated by GABA. β1 promoter activity, mRNA levels, and subunit protein are decreased by persistent GABAAR activation. The core promoter, 270 bp, contains an initiator element (Inr) at the major transcriptional start site. Three concatenated copies of the 10-bp Inr and its immediate 3′ flanking sequence produce full neural specific activity that is down-regulated by GABA in transiently transfected neocortical neurons. Taking these results together with those of DNase I footprinting, electrophoretic mobility shift analysis, and 2-bp mutagenesis, we conclude that GABA-induced down-regulation of β1 subunit mRNAs involves the differential binding of a sequence-specific basal transcription factor(s) to the Inr. The results support a transcriptional mechanism for the down-regulation of β1 subunit GABAAR gene expression and raises the possibility that altered levels of sequence-specific basal transcription factors may contribute to neurological disorders such as epilepsy.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The properties of human DNA helicase V (HDH V) were studied in greater detail following an improved purification procedure. From 450 g of cultured cells, <0.1 mg of pure protein was isolated. HDH V unwinds DNA unidirectionally by moving in the 3′ to 5′ direction along the bound strand in an ATP- and Mg2+-dependent fashion. The enzyme is not processive and can also unwind partial RNA–RNA duplexes such as HDH IV and HDH VIII. The Mr determined by SDS–PAGE (66 kDa) corresponds to that measured under native conditions, suggesting that HDH V exists as a monomer in the nucleus. Microsequencing of the purified HDH V shows that this enzyme is identical to the far upstream element-binding protein (FBP), a protein that stimulates the activity of the c-myc gene by binding specifically to the ‘FUSE’ DNA region localized upstream of its promoter. The sequence of HDH V/FBP contains RGG motifs like HDH IV/nucleolin, HDH VIII/G3BP as well as other human RNA and DNA helicases identified by other laboratories.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The adenylate uridylate-rich elements (AREs) mediate the rapid turnover of mRNAs encoding proteins that regulate cellular growth and body response to exogenous agents such as microbes, inflammatory and environmental stimuli. However, the full repertoire of ARE-containing mRNAs is unknown. Here, we explore the distribution of AREs in human mRNA sequences. Computational derivation of a 13-bp ARE pattern was performed using multiple expectation maximization for motif elicitations (MEME) and consensus analyses. This pattern was statistically validated for the specificity towards the 3′-untranslated region and not coding region. The computationally derived ARE pattern is the basis of a database which contains non-redundant full-length ARE-mRNAs. The ARE-mRNA database (ARED; http://rc.kfshrc.edu.sa/ared) reveals that ARE-mRNAs encode a wide repertoire of functionally diverse proteins that belong to different biological processes and are important in several disease states. Cluster analysis was performed using the ARE sequences to demonstrate potential relationships between the type and number of ARE motifs, and the functional characteristics of the proteins.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

JC virus is activated to replicate in glial cells of many AIDS patients with neurological disorders. In human glial cells, the human immunodeficiency virus 1 (HIV-1) Tat protein activates the major late promoter of JC virus through a Tat-responsive DNA element, termed upTAR, which is a recognition site for cellular Purα, a sequence-specific single-stranded DNA binding protein implicated in cell cycle control of DNA replication and transcription. Tat interacts with two leucine-rich repeats in Purα to form a complex that can be immunoprecipitated from cell extracts. Tat enhances the ability of purified glutathione S-transferase-Purα (GST-Purα) to bind the upTAR element. Tat acts synergistically with Purα, in a cell-cycle-dependent manner, to activate transcription at an upTAR element placed upstream of a heterologous promoter. Since Purα is ubiquitously expressed in human cells and since PUR elements are located near many promoters and origins of replication, the Tat-Purα interaction may be implicated in effects of HIV-1 throughout the full range of HIV-1-infected cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Aldose reductase (EC 1.1.1.21) catalyzes the NADPH-mediated conversion of glucose to sorbitol. The hyperglycemia of diabetes increases sorbitol production primarily through substrate availability and is thought to contribute to the pathogenesis of many diabetic complications. Increased sorbitol production can also occur at normoglycemic levels via rapid increases in aldose reductase transcription and expression, which have been shown to occur upon exposure of many cell types to hyperosmotic conditions. The induction of aldose reductase transcription and the accumulation of sorbitol, an organic osmolyte, have been shown to be part of the physiological osmoregulatory mechanism whereby renal tubular cells adjust to the intraluminal hyperosmolality during urinary concentration. Previously, to explore the mechanism regulating aldose reductase levels, we partially characterized the human aldose reductase gene promoter present in a 4.2-kb fragment upstream of the transcription initiation start site. A fragment (-192 to +31 bp) was shown to contain several elements that control the basal expression of the enzyme. In this study, we examined the entire 4.2-kb human AR gene promoter fragment by deletion mutagenesis and transfection studies for the presence of osmotic response enhancer elements. An 11-bp nucleotide sequence (TGGAAAATTAC) was located 3.7 kb upstream of the transcription initiation site that mediates hypertonicity-responsive enhancer activity. This osmotic response element (ORE) increased the expression of the chloramphenicol acetyltransferase reporter gene product 2-fold in transfected HepG2 cells exposed to hypertonic NaCl media as compared with isoosmotic media. A more distal homologous sequence is also described; however, this sequence has no osmotic enhancer activity in transfected cells. Specific ORE mutant constructs, gel shift, and DNA fragment competition studies confirm the nature of the element and identify specific nucleotides essential for enhancer activity. A plasmid construct containing three repeat OREs and a heterologous promoter increased expression 8-fold in isoosmotic media and an additional 4-fold when the transfected cells are subjected to hyperosmotic stress (total approximately 30-fold). These findings will permit future studies to identify the transcription factors involved in the normal regulatory response mechanism to hypertonicity and to identify whether and how this response is altered in a variety of pathologic states, including diabetes.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Notch is a transmembrane receptor that plays a critical role in cell fate determination. In Drosophila, Notch binds to and signals through Suppressor of Hairless. A mammalian homologue of Suppressor of Hairless, named CBF1 (or RBPJk), is a ubiquitous transcription factor whose function in mammalian Notch signaling is unknown. To determine whether mammalian Notch can stimulate transcription through a CBF1-responsive element (RE), we cotransfected a CBF1-RE-containing chloramphenicol acetyltransferase reporter and N1(deltaEC), a constitutively active form of human Notch1 lacking the extracellular domain, into DG75, COS-1, HeLa, and 293T cells, which all contain endogenous CBF1. N1(deltaEC) dramatically increased chloramphenicol acetyltransferase activity in these cells, indicating functional coupling of Notch1 and CBF1. The activity was comparable to that produced by the Epstein-Barr virus protein EBNA2, a well-characterized, potent transactivator of CBF1. To test whether CBF1 and Notch1 interact physically, we tagged CBF1 with an epitope from the influenza virus hemagglutinin or with the N-terminal domain of gal4, and transfected the tagged CBF1 plus N1(deltaEC) into COS-1 cells. Cell lysates were immunoprecipitated and immunoblotted with several anti-Notch1 antibodies [to detect N1(deltaEC)] or with antibodies to hemagglutinin or gal4 (to detect CBF1). Each immunoprecipitate contained a complex of N1(deltaEC) and CBF1. In summary, we find that the truncated, active form of human Notch1, N1(deltaEC), binds CBF1 and activates transcription through a CBF1-RE-containing promoter. We conclude that CBF1 is a critical downstream protein in the human Notch1 signaling pathway.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The TATA box-binding protein (TBP) is required by all three eukaryotic RNA polymerases for correct initiation of transcription of ribosomal, messenger, small nuclear, and transfer RNAs. The cocrystal structure of the C-terminal/core region of human TBP complexed with the TATA element of the adenovirus major late promoter has been determined at 1.9 angstroms resolution. Structural and functional analyses of the protein-DNA complex are presented, with a detailed comparison to our 1.9-angstroms resolution structure of Arabidopsis thaliana TBP2 bound to the same TATA box.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Rev-erb alpha belongs to the nuclear receptor superfamily, which contains receptors for steroids, thyroid hormones, retinoic acid, and vitamin D, as well as "orphan" receptors. No ligand has been found for Rev-erb alpha to date, making it one of these orphan receptors. Similar to some other orphan receptors, Rev-erb alpha has been shown to bind DNA as a monomer on a specific sequence called a Rev-erb alpah responsive element (RevRE), but its transcriptional activity remains unclear. In this paper, we characterize a functional RevRE located in the human Rev-erb alpha promoter itself. We also present evidence that (i) Rev-erb alpha mediates transcriptional repression of its own promoter in vitro, (ii) this repressing effect strictly depends on the binding of Rev-erb alpha to its responsive element and is transferable to a heterologous promoter; and (iii) Rev-erb alpha binds to this responsive sequence as a homodimer.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The human immunodeficiency virus type 1 (HIV-1) Rev protein is required for nuclear export of late HIV-1 mRNAs. This function is dependent on the mutationally defined Rev activation domain, which also forms a potent nuclear export signal. Transcription factor IIIA (TFIIIA) binds to 5S rRNA transcripts and this interaction has been proposed to play a role in the efficient nuclear export of 5S rRNA in amphibian oocytes. Here it is reported that amphibian TFIIIA proteins contain a sequence element with homology to the Rev activation domain that effectively substitutes for this domain in inducing the nuclear export of late HIV-1 mRNAs. It is further demonstrated that this TFIIIA sequence element functions as a protein nuclear export signal in both human cells and frog oocytes. Thus, this shared protein motif may play an analogous role in mediating the nuclear export of both late HIV-1 RNAs and 5S rRNA transcripts.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In human immunodeficiency virus type 1-infected cells, the efficient expression of viral proteins from unspliced and singly spliced RNAs is dependent on two factors: the presence in the cell of the viral protein Rev and the presence in the viral RNA of the Rev-responsive element (RRE). We show here that the HIV-1 Rev/RRE system can increase the expression of avian leukosis virus (ALV) structural proteins in mammalian cells (D-17 canine osteosarcoma) and promote the release of mature ALV virions from these cells. In this system, the Rev/RRE interaction appears to facilitate the export of full-length unspliced ALV RNA from the nucleus to the cytoplasm, allowing increased production of the ALV structural proteins. Gag protein is produced in the cytoplasm of the ALV-transfected cells even in the absence of a Rev/RRE interaction. However, a functional Rev/RRE interaction increases the amount of Gag present intracellularly and, more strikingly, results in the release of mature ALV particles into the supernatant. RCAS virus containing an RRE is replication-competent in chicken embryo fibroblasts; however, we have been unable to determine whether the particles produced in D-17 cells are as infectious as the particles produced in chicken embryo fibroblasts.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Human peripheral blood lymphocytes (PBLs) were transduced with a number of recombinant retroviruses including RRz2, an LNL6-based virus with a ribozyme targeted to the human immunodeficiency virus (HIV) tat gene transcript inserted within the 3' region of the neomycin-resistance gene; RASH5, and LNHL-based virus containing an antisense sequence to the 5' leader region of HIV-1 downstream of the human cytomegalovirus promoter; and R20TAR, an LXSN-based virus with 20 tandem copies of the HIV-1 trans-activation response element sequence driven by the Moloney murine leukemia virus long terminal repeat. After G418 selection, transduced PBLs were challenged with the HIV-1 laboratory strain IIIB and a primary clinical isolate of HIV-1, 82H. Results showed that PBLs from different donors could be transduced and that this conferred resistance to HIV-1 infection. For each of the constructs, a reduction of approximately 70% in p24 antigen level relative to the corresponding control-vector-transduced PBLs was observed. Molecular analyses showed constitutive expression of all the transduced genes from the retroviral long terminal repeat, but no detectable transcript was seen from the internal human cytomegalovirus transcript was seen from the internal human cytomegalovirus promoter for the antisense construct. Transduction of, and consequent transgene expression in, PBLs did not impact on the surface expression of either CD4+/CD8+ (measured by flow cytometry) or on cell doubling time (examined by [3H]thymidine uptake). These results indicate the potential utility of these anti-HIV-1 gene therapeutic agents and show the preclinical value of this PBL assay system.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The trans-activation response element (TAR) found near the 5' end of the viral RNA of the human immunodeficiency virus contains a 3-nt bulge that is recognized by the virally encoded trans-activator protein (Tat), an important mediator of transcriptional activation. Insertion of the TAR bulge into double-stranded RNA is known to result in reduced electrophoretic mobility, suggestive of a bulge-induced bend. Furthermore, NMR studies indicate that Arg causes a change in the structure of the TAR bulge, possibly reducing the bulge angle. However, neither of these effects has been quantified, nor have they been compared with the effects of the TAR-Tat interaction. Recently, an approach for the quantification of bulge-induced bends has been described in which hydrodynamic measurements, employing the method of transient electric birefringence, have yielded precise estimates for the angles of a series of RNA bulges, with the angles ranging from 7 degrees to 93 degrees. In the current study, transient electric birefringence measurements indicate that the TAR bulge introduces a bend of 50 degrees +/- 5 degrees in the absence of Mg2+. Addition of Arg leads to essentially complete straightening of the helix (to < 10 degrees) with a transition midpoint in the 1 mM range. This transition demonstrates specificity for the TAR bulge: no comparable transition was observed for U3 or A3 (control) bulges with differing flanking sequences. An essentially identical structural transition is observed for the Tat-derived peptide, although the transition midpoint for the latter is near 1 microM. Finally, low concentrations of Mg2+ alone reduce the bend angle by approximately 50%, consistent with the effects of Mg2+ on other pyrimidine bulges. This last observation is important in view of the fact that most previous structural/binding studies were performed in the absence of Mg2+.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.