Avaliação dos fatores de virulência, atividade antimicrobiana e viabilidade celular de bactéria cariogênica na presença do Terpinen-4-ol: estudo in vitro

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Diminuição da expressão dos genes APP e CP em doentes de Alzheimer sugere alteração da exportação de ferro celular nesta demência

Recentemente tem-se assistido a um acumular de evidência sugerindo a implicação de uma desregulação do metabolismo do ferro (Fe) na fisiopatologia da doença de Alzheimer (DA). Neste trabalho, pretendemos esclarecer melhor os mecanismos moleculares subjacentes à homeostasia deste metal na DA, particularmente ao nível do efluxo celular. Assim, mediu-se em células mononucleares do sangue periférico de 73 doentes com DA e 74 controlos a expressão de genes diretamente envolvidos na regulação e exportação celular de Fe, utilizando a técnica de PCR quantitativo. Os resultados mostraram uma diminuição significativa na expressão dos genes aconitase (ACO1; P=0,007); ceruloplasmina (CP; P<0,001) e proteína precursora de beta amilóide (APP; P=0,006) em doentes com DA comparativamente com os voluntários saudáveis. Estas observações apontam para uma diminuição significativa da expressão dos genes associados com a exportação de Fe celular mediada pela ferroportina na DA. Assim, o presente estudo reforça resultados anteriores que mostram alterações no metabolismo do Fe e podem estar na origem da retenção intracelular deste metal e aumento de stress oxidativo caraterísticos desta patologia.

Expressão e regulação do ligando RANK na leucemia de células T

Dissertação de Mestrado, Oncobiologia, Departamento de Ciências Biomédicas e Medicina, Universidade do Algarve, 2016

Efeito da terapia periodontal na microbiota subgengival: parâmetros clínicos e microbiológicos comparativos de PCR semi quantitativo e PCR em tempo real

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Estudo quantitativo da infecção por Babesia bovis em bovinos de corte de diferentes grupos genéticos

Pós-graduação em Genética e Melhoramento Animal - FCAV

Prevalence and occurrence of zoonotic bacterial pathogens in surface waters determined by quantitative PCR

The prevalence and concentrations of Campylobacter jejuni, Salmonella spp. and enterohaemorrhagic E. coli (EHEC) were investigated in surface waters in Brisbane, Australia using quantitative PCR (qPCR) based methodologies. Water samples were collected from Brisbane City Botanic Gardens (CBG) Pond, and two urban tidal creeks (i.e., Oxley Creek and Blunder Creek). Of the 32 water samples collected, 8 (25%), 1 (3%), 9 (28%), 14 (44%), and 15 (47%) were positive for C. jejuni mapA, Salmonella invA, EHEC O157 LPS, EHEC VT1, and EHEC VT2 genes, respectively. The presence/absence of the potential pathogens did not correlate with either E. coli or enterococci concentrations as determined by binary logistic regression. In conclusion, the high prevalence, and concentrations of potential zoonotic pathogens along with the concentrations of one or more fecal indicators in surface water samples indicate a poor level of microbial quality of surface water, and could represent a significant health risk to users. The results from the current study would provide valuable information to the water quality managers in terms of minimizing the risk from pathogens in surface waters.

Evaluation of multiple sewage-associated bacteroides PCR markers for sewage pollution tracking

The host specificity of the five published sewage-associated Bacteroides markers (i.e., HF183, BacHum, HuBac, BacH and Human-Bac) was evaluated in Southeast Queensland, Australia by testing fecal DNA samples (n = 186) from 11 animal species including human fecal samples collected via influent to a sewage treatment plant (STP). All human fecal samples (n = 50) were positive for all five markers indicating 100% sensitivity of these markers. The overall specificity of the HF183 markers to differentiate between humans and animals was 99%. The specificities of the BacHum and BacH markers were > 94%, suggesting that these markers are suitable for sewage pollution in environmental waters in Australia. The BacHum (i.e., 63% specificity) and Human-Bac (i.e., 79% specificity) markers performed poorly in distinguishing between the sources of human and animal fecal samples. It is recommended that the specificity of the sewage-associated markers must be rigorously tested prior to its application to identify the sources of fecal pollution in environmental waters.

A nested real-time PCR assay has an increased sensitivity suitable for detection of viruses in aerosol studies

Aims: Influenza is commonly spread by infectious aerosols; however, detection of viruses in aerosols is not sensitive enough to confirm the characteristics of virus aerosols. The aim of this study was to develop an assay for respiratory viruses sufficiently sensitive to be used in epidemiological studies. Method: A two-step, nested real-time PCR assay was developed for MS2 bacteriophage, and for influenza A and B, parainfluenza 1 and human respiratory syncytial virus. Outer primer pairs were designed to nest each existing real-time PCR assay. The sensitivities of the nested real-time PCR assays were compared to those of existing real-time PCR assays. Both assays were applied in an aerosol study to compare their detection limits in air samples. Conclusions: The nested real-time PCR assays were found to be several logs more sensitive than the real-time PCR assays, with lower levels of virus detected at lower Ct values. The nested real-time PCR assay successfully detected MS2 in air samples, whereas the real-time assay did not. Significance and Impact of the Study: The sensitive assays for respiratory viruses will permit further research using air samples from naturally generated virus aerosols. This will inform current knowledge regarding the risks associated with the spread of viruses through aerosol transmission.

Single nucleotide polymorphism (SNP) - genotyping of Community Acquired Methicillin-Resistant Staphylococcus aureus, including the subtyping of PVL toxin producers using Real-Time PCR

Staphylococcus aureus is a common pathogen that causes a variety of infections including soft tissue infections, impetigo, septicemia toxic shock and scalded skin syndrome. Traditionally, Methicillin-Resistant Staphylococcus aureus (MRSA) was considered a Hospital-Acquired (HA) infection. It is now recognised that the frequency of infections with MRSA is increasing in the community, and that these infections are not originating from hospital environments. A 2007 report by the Centers for Disease Control and Prevention (CDC) stated that Staphylococcus aureus is the most important cause of serious and fatal infections in the USA. Community-Acquired MRSA (CA-MRSA) are genetically diverse and distinct, meaning they are able to be identified and tracked by way of genotyping. Genotyping of MRSA using Single nucleotide polymorphisms (SNPs) is a rapid and robust method for monitoring MRSA, specifically ST93 (Queensland Clone) dissemination in the community. It has been shown that a large proportion of CA-MRSA infections in Queensland and New South Wales are caused by ST93. The rationale for this project was that SNP analysis of MLST genes is a rapid and cost-effective method for genotyping and monitoring MRSA dissemination in the community. In this study, 16 different sequence types (ST) were identified with 41% of isolates identified as ST93 making it the predominate clone. Males and Females were infected equally with an average patient age of 45yrs. Phenotypically, all of the ST93 had an identical antimicrobial resistance pattern. They were resistant to the β-lactams – Penicillin, Flu(di)cloxacillin and Cephalothin but sensitive to all other antibiotics tested. Virulence factors play an important role in allowing S. aureus to cause disease by way of colonising, replication and damage to the host. One virulence factor of particular interest is the toxin Panton-Valentine leukocidin (PVL), which is composed of two separate proteins encoded by two adjacent genes. PVL positive CA-MRSA are shown to cause recurrent, chronic or severe skin and soft tissue infections. As a result, it is important that PVL positive CA-MRSA is genotyped and tracked. Especially now that CA-MRSA infections are more prevalent than HA-MRSA infections and are now deemed endemic in Australia. 98% of all isolates in this study tested positive for the PVL toxin gene. This study showed that PVL is present in many different community based ST, not just ST93, which were all PVL positive. With this toxin becoming entrenched in CA-MRSA, genotyping would provide more accurate data and a way of tracking the dissemination. PVL gene can be sub-typed using an allele-specific Real-Time PCR (RT-PCR) followed by High resolution meltanalysis. This allows the identification of PVL subtypes within the CA-MRSA population and allow the tracking of these clones in the community.

Quantitative PCR assay of sewage-associated Bacteroides markers to assess sewage pollution in an urban lake in Dhaka, Bangladesh

This paper aimed to assess the magnitude of sewage pollution in an urban lake in Dhaka, Bangladesh by using Quantitative PCR (qPCR) of sewage-associated Bacteroides HF183 markers. PCR was also used for the quantitative detection of ruminant wastewater-associated CF128 markers along with the enumeration of traditional fecal indicator bacteria, namely, enterococci. The number of enterococci in lake water samples ranged from 1.1 x 104 to 1.9 x 105 CFU/100 ml of water. From the 20 water samples tested, 14 (70%) and 7 (35%) were PCR positive for the HF183 and CF128 markers, respectively. The numbers of the HF183 and CF128 markers in lake water samples were 3.9 x 104 to 6.3 × 107 and 9.3 x 103 to 6.3 x 105 genomic units (GU)/100 ml of water, respectively. The high numbers of enterococci and the HF183 markers indicate sewage pollution and potential health risks to those who use the lake water for non-potable purposes such as bathing and washing clothes. This is the first study that investigated the presence of microbial source tracking (MST) markers in Dhaka, Bangladesh where diarrhoeal diseases is one of the major causes of childhood mortality. The molecular assay as used in this study can provide valuable information on the extent of sewage pollution, thus facilitating the development of robust strategies to minimise potential health risks.

Highly discriminatory single-nucleotide polymorphism interrogation of Escherichia coli by use of allele-specific real-time PCR and eBURST analysis

In total, 782 Escherichia coli strains originating from various host sources have been analyzed in this study by using a highly discriminatory single-nucleotide polymorphism (SNP) approach. A set of eight SNPs, with a discrimination value (Simpson's index of diversity [D]) of 0.96, was determined using the Minimum SNPs software, based on sequences of housekeeping genes from the E. coli multilocus sequence typing (MLST) database. Allele-specific real-time PCR was used to screen 114 E. coli isolates from various fecal sources in Southeast Queensland (SEQ). The combined analysis of both the MLST database and SEQ E. coli isolates using eight high-D SNPs resolved the isolates into 74 SNP profiles. The data obtained suggest that SNP typing is a promising approach for the discrimination of host-specific groups and allows for the identification of human-specific E. coli in environmental samples. However, a more diverse E. coli collection is required to determine animal- and environment-specific E. coli SNP profiles due to the abundance of human E. coli strains (56%) in the MLST database.

Identification of circulating tumour cells in early stage breast cancer patients using multi marker immunobead RT-PCR

Introduction The ability to screen blood of early stage operable breast cancer patients for circulating tumour cells is of potential importance for identifying patients at risk of developing distant relapse. We present the results of a study of the efficacy of the immunobead RT-PCR method in identifying patients with circulating tumour cells. Results Immunomagnetic enrichment of circulating tumour cells followed by RT-PCR (immunobead RT-PCR) with a panel of five epithelial specific markers (ELF3, EPHB4, EGFR, MGB1 and TACSTD1) was used to screen for circulating tumour cells in the peripheral blood of 56 breast cancer patients. Twenty patients were positive for two or more RT-PCR markers, including seven patients who were node negative by conventional techniques. Significant increases in the frequency of marker positivity was seen in lymph node positive patients, in patients with high grade tumours and in patients with lymphovascular invasion. A strong trend towards improved disease free survival was seen for marker negative patients although it did not reach significance (p = 0.08). Conclusion Multi-marker immunobead RT-PCR analysis of peripheral blood is a robust assay that is capable of detecting circulating tumour cells in early stage breast cancer patients.

PCR bias Toward the wild-type k-ras and p53 sequences: Implications for PCR detection of mutations and cancer diagnosis

PCR-based cancer diagnosis requires detection of rare mutations in k- ras, p53 or other genes. The assumption has been that mutant and wild-type sequences amplify with near equal efficiency, so that they are eventually present in proportions representative of the starting material. Work on factor IX suggests that this assumption is invalid for one case of near- sequence identity. To test the generality of this phenomenon and its relevance to cancer diagnosis, primers distant from point mutations in p53 and k-ras were used to amplify wild-type and mutant sequences from these genes. A substantial bias against PCR amplification of mutants was observed for two regions of the p53 gene and one region of k-ras. For k-ras and p53, bias was observed when the wild-type and mutant sequences were amplified separately or when mixed in equal proportions before PCR. Bias was present with proofreading and non-proofreading polymerase. Mutant and wild-type segments of the factor V, cystic fibrosis transmembrane conductance regulator and prothrombin genes were amplified and did not exhibit PCR bias. Therefore, the assumption of equal PCR efficiency for point mutant and wild-type sequences is invalid in several systems. Quantitative or diagnostic PCR will require validation for each locus, and enrichment strategies may be needed to optimize detection of mutants.