The measurement of adenosine and estrogen receptor expression in rat brains following ovariectomy using quantitative PCR analysis

In our laboratory we have developed a quantitative-polymerase chain reaction (Q-PCR) strategy to examine the differential expression of adenosine receptor (ADOR), A(1), A(2A), A(2B) and A(3), and estrogen receptors (ER) alpha and beta. Brain and uterine mRNA were first used to optimise specific amplification conditions prior to SYBR Green I real time analysis of receptor subtype expression. SYBR Green I provided a convenient and sensitive means of examining specific PCR amplification product in real time, and allowed the generation of standard curves from which relative receptor abundance could be determined. Real time Q-PCR analysis was then performed, to examine changes in receptor expression levels in brains of adult female Wistar rats 3-month post ovariectomy. Comparison with sham-operated age-matched control rats demonstrated both comparative and absolute-copy number changes in receptor levels. Evaluation of both analytical methods investigated 18S rRNA as an internal reference for comparative gene expression analysis in the brain. The results of this study revealed preferential repression of ADORA(2A) (>4-fold down) and consistent (>2-fold) down-regulation of ADORA(1), ADORA(3), and ER-beta, following ovariectomy. No change was found in ADORA(2B) or ER-alpha. Analysis of absolute copy number in this study revealed a correlation between receptor expression in response to ovariectomy, and relative receptor subtype abundance in the brain.

Locked nucleic acid (LNA) single nucleotide polymorphism (SNP) genotype analysis and validation using real-time PCR

With an increased emphasis on genotyping of single nucleotide polymorphisms (SNPs) in disease association studies, the genotyping platform of choice is constantly evolving. In addition, the development of more specific SNP assays and appropriate genotype validation applications is becoming increasingly critical to elucidate ambiguous genotypes. In this study, we have used SNP specific Locked Nucleic Acid (LNA) hybridization probes on a real-time PCR platform to genotype an association cohort and propose three criteria to address ambiguous genotypes. Based on the kinetic properties of PCR amplification, the three criteria address PCR amplification efficiency, the net fluorescent difference between maximal and minimal fluorescent signals and the beginning of the exponential growth phase of the reaction. Initially observed SNP allelic discrimination curves were confirmed by DNA sequencing (n = 50) and application of our three genotype criteria corroborated both sequencing and observed real-time PCR results. In addition, the tested Caucasian association cohort was in Hardy-Weinberg equilibrium and observed allele frequencies were very similar to two independently tested Caucasian association cohorts for the same tested SNP. We present here a novel approach to effectively determine ambiguous genotypes generated from a real-time PCR platform. Application of our three novel criteria provides an easy to use semi-automated genotype confirmation protocol.

Development of a rapid, sensitive and specific diagnostic assay for fish Aquareovirus based on RT-PCR

A rapid, sensitive and highly specific detection method for Aquareovirus based on reverse-transcription polymerase chain reaction (RT-PCR) was developed. Based on multiple sequence alignment of the cloned sequences of a local isolates, the Threadfin reovirus (TFV) and Guppy reovirus (GPV) with Grass carp reovirus (GCRV), a pair of degenerate primers was selected carefully and synthesized. Using this primer combination, only one specific product, approximately 450 bp in length was obtained when RT-PCR was carried out using the genomic double-stranded RNA (dsRNA) of TFV, GPV and GCRV. Similar results were also obtained when Chum salmon reovirus (CSRV) and Striped bass reovirus (SBRV) dsRNA were used as templates. No products were observed when nucleic acids other than the dsRNA of the aquareoviruses described above were used as RT-PCR templates. This technique could detect not only TFV but also GPV and GCRV in low titer virus-infected cell cultured cells. Furthermore, this method has also been shown to be able to diagnose GPV-infected guppy (Poecilia reticulata) that exhibit clinical symptoms as well as GPV-carrier guppy. Collectively, these results showed that the RT-PCR amplification method using specific degenerate primers described below is very useful for rapid and accurate detection of a variety of aquareovirus strains isolated from different host species and origin. (C) 2004 Elsevier B.V. All rights reserved.

Detection of Avian Influenza Virus with PCR-Like Sensitivity by Fluorescent DNA Barcode-Based Immunoassay

In this paper, we report a coupling of fluorophore-DNA barcode and bead-based
immunoassay for the detection of Avian Influenza Virus (AIV), a potential pandemic threat for human health and enormous economic losses. The detection strategy is based on the use of sandwich immunoassay and fluorophore-tagged oligonucleotides as representatively fluorescent barcodes. Despite its simplicity the assay has sensitivity comparable to RT-PCR amplification, and possesses a great potential as a rapid and sensitive on-chip detection format.

Rapid quantification of microRNAs in plasma using a fast real time PCR system

The ability to rapidly detect circulating small RNAs, in particular microRNAs (miRNAs), would further increase their already established potential as biomarkers in a range of conditions. One rate-limiting factor is the time taken to perform quantitative real time PCR amplification. We therefore evaluated the ability of a novel thermal cycler to perform this step in less than 10 minutes. Quantitative PCR was performed on an xxpress® thermal cycler (BJS Biotechnologies, Perivale, UK), which employs a resistive heating system and forced air cooling to achieve thermal ramp rates of 10 °C/s, and a conventional peltier-controlled LightCycler 480 system (Roche, Basel, Switzerland) ramping at 4.8 °C/s. The threshold cycle (Ct) for detection of 18S rDNA from a standard genomic DNA sample was significantly more variable across the block (F-test, p=2.4x10-25) for the xxpress (20.01±0.47SD) than the LightCycler (19.87±0.04SD). RNA was extracted from human plasma, reverse transcribed and a panel of miRNAs amplified and detected using SYBR green (Kapa Biosystems, Wilmington, Ma, USA). The sensitivity of both systems was broadly comparable and both detected a panel of miRNAs reliably and indicated similar relative abundances. The xxpress thermal cycler facilitates rapid qPCR detection of small RNAs and brings point-of care diagnostics based upon circulating miRNAs a step closer to reality.

Detection and enumeration of sulphate-reducing bacteria in estuarine sediments by competitive PCR

The distribution of sulphate-reducing bacteria (SRB) in the sediments of the Colne River estuary, Essex, UK covering different saline concentrations of sediment porewater was investigated by the use of quantitative competitive PCR. Here, we show that a new PCR primer set and a new quantitative method using PCR are useful tools for the detection and the enumeration of SRB in natural environments. A PCR primer set selective for the dissimilatory sulphite reductase gene (dsr) of SRB was designed. PCR amplification using the single set of dsr-specific primers resulted in PCR products of the expected size from all 27 SRB strains tested, including Gram-negative and positive species. Sixty clones derived from sediment DNA using the primers were sequenced and all were closely related with the predicted dsr of SRB. These results indicate that PCR using the newly designed primer set are useful for the selective detection of SRB from a natural sample. This primer set was used to estimate cell numbers by dsr selective competitive PCR using a competitor, which was about 20% shorter than the targeted region of dsr. This procedure was applied to sediment samples from the River Colne estuary, Essex, UK together with simultaneous measurement of in situ rates of sulphate reduction. High densities of SRB ranging from 0.2 - 5.7 × 108 cells ml-1 wet sediment were estimated by the competitive PCR assuming that all SRB have a single copy of dsr. Using these estimates cell specific sulphate reduction rates of 10-17 to 10-15 mol of SO42- cell-1 day-1 were calculated, which is within the range of, or lower than, those previously reported for pure cultures of SRB. Our results show that the newly developed competitive PCR technique targeted to dsr is a powerful tool for rapid and reproducible estimation of SRB numbers in situ and is superior to the use of culture-dependent techniques.

Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria

Identification of Fusarium species has always been difficult due to confusing phenotypic classification systems. We have developed a fluorescent-based polymerase chain reaction assay that allows for rapid and reliable identification of five toxigenic and pathogenic Fusarium species. The species includes Fusarium avenaceum, F. culmorum, F. equiseti, F. oxysporum and F. sambucinum. The method is based on the PCR amplification of species-specific DNA fragments using fluorescent oligonucleotide primers, which were designed based on sequence divergence within the internal transcribed spacer region of nuclear ribosomal DNA. Besides providing an accurate, reliable, and quick diagnosis of these Fusaria, another advantage with this method is that it reduces the potential for exposure to carcinogenic chemicals as it substitutes the use of fluorescent dyes in place of ethidium, bromide. Apart from its multidisciplinary importance and usefulness, it also obviates the need for gel electrophoresis. (C) 2002 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies.

Extracting DNA from museum bird eggs, and whole genome amplification of archive DNA

We present a comprehensive protocol for extracting DNA from egg membranes and other internal debris recovered from the interior of blown museum bird eggs. A variety of commercially available DNA extraction methods were found to be applicable. DNA sequencing of polymerase chain reaction (PCR) products for a 176-bp fragment of mitochondrial DNA was successful for most egg samples (> 78%) even though the amount of DNA extracted (mean = 14.71 ± 4.55 ng/µL) was significantly less than that obtained for bird skin samples (mean = 67.88 ± 4.77 ng/µL). For PCR and sequencing of snipe (Gallinago) DNA, we provide eight new primers for the ‘DNA barcode’ region of COI mtDNA. In various combinations, the primers target a range of PCR products sized from 72 bp to the full ‘barcode’ of 751 bp. Not all possible combinations were tested with archive snipe DNA, but we found a significantly better success rate of PCR amplification for a shorter 176-bp target compared with a larger 288-bp fragment (67% vs. 39%). Finally, we explored the feasibility of whole genome amplification (WGA) for extending the use of archive DNA in PCR and sequencing applications. Of two WGA approaches, a PCR-based method was found to be able to amplify whole genomic DNA from archive skins and eggs from museum bird collections. After WGA, significantly more archive egg samples produced visible PCR products on agarose (56.9% before WGA vs. 79.0% after WGA). However, overall sequencing success did not improve significantly (78.8% compared with 83.0%).

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Avaliação de dois métodos de extração de DNA de material parafinado para amplificação em PCR

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Real-time PCR assay targeting the actin gene for the detection of Cryptosporidium parvum in calf fecal samples

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.

Avaliação da diluição do DNA extraido de material parafinado para amplificação em PCR

Introduction: Several reasons may lead to the failure of polymerase chain reaction (PCR) using DNA purified from paraffin-embedded materials: presence of inhibitors and degradation of target DNA. DNA dilution will often reduce the concentration of potential inhibitors and still contain enough DNA to allow PCR amplification. Objective: To evaluate the dilution influence of DNA purified from paraffin-embedded materials on β-globin PCR amplification. Material and Method: Paraffin-embedded blocks from 30 patients with oropharynx squamous cell carcinomas, diagnosed and treated at the Oral Oncology Center were selected. DNA extraction was performed using QIAmp minikit (Quiagen). DNA was quantified and evaluated for purity by spectrophotometer analysis. Two groups were formed with different amounts of DNA: group I had the originally extracted DNA and group II had the same DNA, however diluted with ultrapure water addition. PCR was performed in both groups using oligonucleotides for human β-globin gene. Results: For Group I, amplification of the β-globin gene sequence was successful in 33.33% of the samples and for Group II, in 23.33%. Conclusion: Dilution of the DNA extracted of paraffin-embedded materials did not modify statistically the amount of positive samples β-globin gene amplified in PCR, although the results suggest that this is a way to increase the method for efficacy amplification of PCR.

Real-time PCR assay targeting the actin gene for the detection of Cryptosporidium parvum in calf fecal samples

Cryptosporidium parvum infection is very important with respect to public health, owing to foodborne and waterborne outbreaks and gastrointestinal illness in immunocompetent and immunocompromised persons. In cattle, infection with this species manifests either as a subclinical disease or with diarrheal illness, which occurs more often in the presence of other infectious agents than when alone. The aim of this study was to develop a real-time polymerase chain reaction (PCR) assay for the detection of C. parvum in calf fecal samples and to compare the results of this assay with those of the method routinely used for the diagnosis of Cryptosporidium spp., nested PCR targeting the 18S rRNA gene. Two hundred and nine fecal samples from calves ranging in age from 1 day to 6 months were examined using real-time PCR specific for the actin gene of C. parvum and by a nested PCR targeting the 18S rRNA gene of Cryptosporidium spp. Using real-time PCR detection, 73.2% (153 out of 209) of the samples were positive for C. parvum, while 56.5% (118 out of 209) of the samples were positive for Cryptosporidium spp. when the nested PCR amplification method was used for the detection. The analytical sensitivity of the real-time PCR was approximately one C. parvum oocyst. There was no significant nonspecific DNA amplification of any of the following species and genotype: Cryptosporidium andersoni, Cryptosporidium baileyi, Cryptosporidium bovis, Cryptosporidium canis, Cryptosporidium galli, Cryptosporidium ryanae, Cryptosporidium serpentis, or avian genotype II. Thus, we conclude that real-time PCR targeting the actin gene is a sensitive and specific method for the detection of C. parvum in calf fecal samples.

APPLICABILITY OF kDNA-PCR FOR ROUTINE DIAGNOSIS OF AMERICAN TEGUMENTARY LEISHMANIASIS IN A TERTIARY REFERENCE HOSPITAL.

This study evaluated the applicability of kDNA-PCR as a prospective routine diagnosis method for American tegumentary leishmaniasis (ATL) in patients from the Instituto de Infectologia Emílio Ribas (IIER), a reference center for infectious diseases in São Paulo - SP, Brazil. The kDNA-PCR method detected Leishmania DNA in 87.5% (112/128) of the clinically suspected ATL patients, while the traditional methods demonstrated the following percentages of positivity: 62.8% (49/78) for the Montenegro skin test, 61.8% (47/76) for direct investigation, and 19.3% (22/114) for in vitro culture. The molecular method was able to confirm the disease in samples considered negative or inconclusive by traditional laboratory methods, contributing to the final clinical diagnosis and therapy of ATL in this hospital. Thus, we strongly recommend the inclusion of kDNA-PCR amplification as an alternative diagnostic method for ATL, suggesting a new algorithm routine to be followed to help the diagnosis and treatment of ATL in IIER.