1000 resultados para Nucleotide sequence


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The complete nucleotide sequence of rice tungro spherical virus (RTSV) strain Vt6, originally from Mindanao, the Philippines, with higher virulence to resistant rice cultivars, was determined and compared with the published sequence for the Philippine-type strain A (RTSV-A-Shen). It was reported that RTSV-A was not able to infect a rice resistant cultivar TKM 6 (10). RTSV-Vt6 and RTSV-A-Shen share 90% and 95% homology at nucleotide and amino-acid levels, respectively. The N-terminal leader sequence of RTSV-Vt6 contained a 39-amino acids-region (positions 65 to 103) which was totally different from that of RTSV-A-Shen; the difference resulted from frame shifting by nucleotide insertions and deletions. To confirm the amino-acid sequence differences of the leader polypeptide, the same region was cloned and sequenced using a newly obtained variant of RTSV-type 6, which had been collected in the field of IRRI, and seven field isolates from Mindanao, the Philippines. Since all the sequences of the target region are identical to that of the Vt6 leader polypeptide, the sequence difference in the leader region seems not to correlate with the virulence of Vt6.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The complete nucleotide sequence of Subterranean clover mottle virus (SCMoV) genomic RNA has been determined. The SCMoV genome is 4,258 nucleotides in length. It shares most nucleotide and amino acid sequence identity with the genome of Lucerne transient streak virus (LTSV). SCMoV RNA encodes four overlapping open reading frames and has a genome organisation similar to that of Cocksfoot mottle virus (CfMV). ORF1 and ORF4 are predicted to encode single proteins. ORF2 is predicted to encode two proteins that are derived from a -1 translational frameshift between two overlapping reading frames (ORF2a and ORF2b). A search of amino acid databases did not find a significant match for ORF1 and the function of this protein remains unclear. ORF2a contains a motif typical of chymotrypsin-like serine proteases and ORF2b has motifs characteristically present in positive-stranded RNA-dependent RNA polymerases. ORF4 is likely to be expressed from a subgenomic RNA and encodes the viral coat protein. The ORF2a/ORF2b overlapping gene expression strategy used by SCMoV and CfMV is similar to that of the poleroviruses and differ from that of other published sobemoviruses. These results suggest that the sobemoviruses could now be divided into two distinct subgroups based on those that express the RNA-dependent RNA polymerase from a single, in-frame polyprotein, and those that express it via a -1 translational frameshifting mechanism.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

GPV is a Chinese serotype isolate of barley yellow dwarf virus (BYDV) that has no reaction with antiserum of MAV, PAV, SGV, RPV and RMV The sequence of the coat protein (CP) of GPV isolate of BYDV was identified and its amino acid sequence was deduced. The coding region for the putative GPV CP is 603 bases nucleotides and encodes a Mr 22 218 (22 ku) protein. The same as MAV, PAV and RPV, GPV contained a second ORF within the coat protein coding region. This protein of 17 024 Mr (17 ku) is thought to correspond to the Virion protein genome linked (Vpg). Sequence comparisons of the CP coding region between the GPV isolate of BYDV and other isolates of BYDV have been done. The nucleotide and amino acid sequence homology of GPV has a greater identity to the sequence of RPV than those of PAV and MAV. The GPV CP sequence stored 83.7% of nucleotide similarity and 77.5% of deduced amino acid similarity, whereas that of the PAV and MAV shared 56.9%, 53.2% and 44.1%, 43.8% respectively. According to BYDV-GPV CP sequence, two primers were designed. The cDNA of CP was produced by RT-PCR. Full-length cDNA of CP was inserted into plasmid to construct expression plasmids named pPPI1, pPPI2 and pPPI5 based on different promoters. The recombinant plasmids were identified by using α-32P-dATP labelled CP probe, α-32P-ATP labelled GPV RNA probe and sequencing to confirm real GPV CP gene cDNA in plasmids.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Molecular phylogenetic studies of homologous sequences of nucleotides often assume that the underlying evolutionary process was globally stationary, reversible, and homogeneous (SRH), and that a model of evolution with one or more site-specific and time-reversible rate matrices (e.g., the GTR rate matrix) is enough to accurately model the evolution of data over the whole tree. However, an increasing body of data suggests that evolution under these conditions is an exception, rather than the norm. To address this issue, several non-SRH models of molecular evolution have been proposed, but they either ignore heterogeneity in the substitution process across sites (HAS) or assume it can be modeled accurately using the distribution. As an alternative to these models of evolution, we introduce a family of mixture models that approximate HAS without the assumption of an underlying predefined statistical distribution. This family of mixture models is combined with non-SRH models of evolution that account for heterogeneity in the substitution process across lineages (HAL). We also present two algorithms for searching model space and identifying an optimal model of evolution that is less likely to over- or underparameterize the data. The performance of the two new algorithms was evaluated using alignments of nucleotides with 10 000 sites simulated under complex non-SRH conditions on a 25-tipped tree. The algorithms were found to be very successful, identifying the correct HAL model with a 75% success rate (the average success rate for assigning rate matrices to the tree's 48 edges was 99.25%) and, for the correct HAL model, identifying the correct HAS model with a 98% success rate. Finally, parameter estimates obtained under the correct HAL-HAS model were found to be accurate and precise. The merits of our new algorithms were illustrated with an analysis of 42 337 second codon sites extracted from a concatenation of 106 alignments of orthologous genes encoded by the nuclear genomes of Saccharomyces cerevisiae, S. paradoxus, S. mikatae, S. kudriavzevii, S. castellii, S. kluyveri, S. bayanus, and Candida albicans. Our results show that second codon sites in the ancestral genome of these species contained 49.1% invariable sites, 39.6% variable sites belonging to one rate category (V1), and 11.3% variable sites belonging to a second rate category (V2). The ancestral nucleotide content was found to differ markedly across these three sets of sites, and the evolutionary processes operating at the variable sites were found to be non-SRH and best modeled by a combination of eight edge-specific rate matrices (four for V1 and four for V2). The number of substitutions per site at the variable sites also differed markedly, with sites belonging to V1 evolving slower than those belonging to V2 along the lineages separating the seven species of Saccharomyces. Finally, sites belonging to V1 appeared to have ceased evolving along the lineages separating S. cerevisiae, S. paradoxus, S. mikatae, S. kudriavzevii, and S. bayanus, implying that they might have become so selectively constrained that they could be considered invariable sites in these species.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Abstract is not available.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

32P labelled 5S RNA isolated fromMycobacterium smegmatis was digested withT 1 and pancreatic ribonucleases separately and fingerprinted by two dimensional high voltage electrophoresis on thin-layer DEAE-cellulose plates. The radioactive spots were sequenced and their molar yields were determined. The chain length of the 5S RNA was found to be 120. It showed resemblances to both prokaryotic and eukaryotic 5S RNAs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The 3' terminal 1255 nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3' terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addiition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nucleotide sequence of cosmid B1790, carrying the Rif-Str regions of the Mycobacterium leprae chromosome, has been determined. Twelve open reading frames were identified in the 36716bp sequence, representing 40% of the coding capacity. Five ribosomal proteins, two elongation factors and the β and β'subunits of RNA polymerase have been characterized and two novel genes were found. One of these encodes a member of the so-called ABC family of ATP-binding proteins while the other appears to encode an enzyme involved in repairing genomic lesions caused by free radicals. This finding may well be significant as M. leprae, an intracellular pathogen, lives within macrophages.