990 resultados para Nuclear Proteins
Resumo:
PURPOSE: To characterize cyan fluorescent protein (CFP) expression in the retina of the thy1-CFP (B6.Cg-Tg(Thy1-CFP)23Jrs/J) transgenic mouse line. METHODS: CFP expression was characterized using morphometric methods and immunohistochemistry with antibodies to neurofilament light (NF-L), neuronal nuclei (NeuN), POU-domain protein (Brn3a) and calretinin, which immunolabel ganglion cells, and syntaxin 1 (HPC-1), glutamate decarboxylase 67 (GAD(67)), GABA plasma membrane transporter-1 (GAT-1), and choline acetyltransferase (ChAT), which immunolabel amacrine cells. RESULTS: CFP was extensively expressed in the inner retina, primarily in the inner plexiform layer (IPL), ganglion cell layer (GCL), nerve fiber layer, and optic nerve. CFP fluorescent cell bodies were in all retinal regions and their processes ramified in all laminae of the IPL. Some small, weakly CFP fluorescent somata were in the inner nuclear layer (INL). CFP-containing somata in the GCL ranged from 6 to 20 microm in diameter, and they had a density of 2636+/-347 cells/mm2 at 1.5 mm from the optic nerve head. Immunohistochemical studies demonstrated colocalization of CFP with the ganglion cell markers NF-L, NeuN, Brn3a, and calretinin. Immunohistochemistry with antibodies to HPC-1, GAD(67), GAT-1, and ChAT indicated that the small, weakly fluorescent CFP cells in the INL and GCL were cholinergic amacrine cells. CONCLUSIONS: The total number and density of CFP-fluorescent cells in the GCL were within the range of previous estimates of the total number of ganglion cells in the C57BL/6J line. Together these findings suggest that most ganglion cells in the thy1-CFP mouse line 23 express CFP. In conclusion, the thy1-CFP mouse line is highly useful for studies requiring the identification of ganglion cells.
Resumo:
Aldosterone plays a major role in the regulation of salt balance and the pathophysiology of cardiovascular and renal diseases. Many aldosterone-regulated genes--including that encoding the epithelial Na+ channel (ENaC), a key arbiter of Na+ transport in the kidney and other epithelia--have been identified, but the mechanisms by which the hormone modifies chromatin structure and thus transcription remain unknown. We previously described the basal repression of ENaCalpha by a complex containing the histone H3 Lys79 methyltransferase disruptor of telomeric silencing alternative splice variant a (Dot1a) and the putative transcription factor ALL1-fused gene from chromosome 9 (Af9) as well as the release of this repression by aldosterone treatment. Here we provide evidence from renal collecting duct cells and serum- and glucocorticoid-induced kinase-1 (Sgk1) WT and knockout mice that Sgk1 phosphorylated Af9, thereby impairing the Dot1a-Af9 interaction and leading to targeted histone H3 Lys79 hypomethylation at the ENaCalpha promoter and derepression of ENaCalpha transcription. Thus, Af9 is a physiologic target of Sgk1, and Sgk1 negatively regulates the Dot1a-Af9 repressor complex that controls transcription of ENaCalpha and likely other aldosterone-induced genes.
Resumo:
Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.
Resumo:
Neurons and their precursor cells are formed in different regions within the developing CNS, but they migrate and occupy very specific sites in the mature CNS. The ultimate position of neurons is crucial for establishing proper synaptic connectivity in the brain. In Drosophila, despite its extensive use as a model system to study neurogenesis, we know almost nothing about neuronal migration or its regulation. In this paper, I show that one of the most studied neuronal pairs in the Drosophila nerve cord, RP2/sib, has a complicated migratory route. Based on my studies on Wingless (Wg) signaling, I report that the neuronal migratory pattern is determined at the precursor cell stage level. The results show that Wg activity in the precursor neuroectodermal and neuroblast levels specify neuronal migratory pattern two divisions later, thus, well ahead of the actual migratory event. Moreover, at least two downstream genes, Cut and Zfh1, are involved in this process but their role is at the downstream neuronal level. The functional importance of normal neuronal migration and the requirement of Wg signaling for the process are indicated by the finding that mislocated RP2 neurons in embryos mutant for Wg-signaling fail to properly send out their axon projection.
Resumo:
Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^
Resumo:
The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^
The effect of v-{\it mos\/} expression on the regulation of the {\it fos\/} promoter in 490N3T cells
Resumo:
The v-mos oncogene acquired by Moloney murine sarcoma viruses by recombination with the c-mos proto-oncogene encodes a 37kD cytoplasmic serine/threonine protein kinase which can phosphorylate tubulin and vimentin, as well as the cyclin B component of the maturation promotion factor complex (MPF). Our earliest experiments asked whether the v-mos protein could activate the transcription of transin. Since the transcription of transin was known to be mediated by both fos-dependent and fos-independent pathways, it seemed possible that the induction of transin transcription by v-mos might be mediated by p55$\sp{\rm c-}\sp{fos}$. Surprisingly, when we examined the effect of v-mos on the fos promoter, we observed a significant inhibition of transcription in 49ON3T cells, a subclone of N1H3T3 mouse fibroblasts.^ In this thesis we show that in mouse 49ON3T cells, transcription from the fos promoter is up to 10-fold repressed in the presence of v-mos. Moreover, in this cell line several other transforming constructs (v-ras, v-src, neu) also cause repression of the fos promoter. Interestingly, nontransforming oncogenes (e.g. myc) do not repress fos transcription. The repressive effect was lost in v-mos mutants lacking in ATP-binding or kinase domain, arguing that the effect on fos transcription was mediated by v-mos transforming kinase activity. As mos is a cytoplasmic protein, it was assumed that transcriptional repression was mediated by conversion of a transcriptional regulator to a repressor by mos-induced phosphorylation. As a first approximation of the identity of this factor, we mapped the position of the mos effect on the fos promoter using reporter (CAT) constructs. We found that repression was mediated by regions $-$221 to $-$106 and $-$122 to $-$65 relative to the fos transcriptional start site, both of which regions regulate baseline fos transcription. There are direct repeats containing E2F transcriptional activator/repressor recognition motifs in these regions which bind similar nuclear proteins independently of v-mos presence or absence. Our data show that the contribution of the direct repeat to baseline fos transcription is mediated by these E2F sites with perhaps some contribution from the overlapping retinoblastoma control element (RCE). We have shown that there is a separate DNA protein interaction in the direct repeat which is more pronounced in the presence of v-mos. The recognition site for this protein, which we speculate mediates the mos-induced downregulation of fos transcription, overlaps but is distinct from the E2F and RCE binding sites. (Abstract shortened by UMI.) ^
Resumo:
Type II collagen is a major chondrocyte-specific component of the cartilage extracellular matrix and it represents a typical differentiation marker of mature chondrocytes. In order to delineate cis-acting elements of the mouse pro$\alpha1$(II) collagen gene that control chondrocyte-specific expression in intact mouse embryos, we generated transgenic mice harboring chimeric constructions in which varying lengths of the promoter and intron 1 sequences were linked to a $\beta$-galactosidase reporter gene. A construction containing a 3000-bp promoter and a 3020-bp intron 1 fragment directed high levels of $\beta$-galactosidase expression specifically to chondrocytes. Successive deletions of intron 1 delineated a 48-bp fragment which targeted $\beta$-galactosidase expression to chondrocytes with the same specificity as the larger intron 1 fragment. When the Col2a1 promoter was replaced with a minimal $\beta$-globin promoter, the 48-bp intron 1 sequence was still able to target expression of the transgene to chondrocytes, specifically. Therefore a 48-bp intron 1 DNA segment of the mouse Col2a1 gene contains the necessary information to confer high-level, temporally correct, chondrocyte expression to a reporter gene in intact mouse embryos and that Col2a1 promoter sequences are dispensable for chondrocyte expression. Nuclear proteins present selectively in mouse primary chondrocytes and rat chondrosarcoma cells bind to the three putative HMG (High-Mobility-Group) domain protein binding sites in this 48-bp sequence and the chondrocyte-specific proteins likely bind the DNA through minor groove. Together, my results indicate that a 48-bp sequence in Col2a1 intron 1 controls chondrocyte-specific expression in vivo and suggest that chondrocytes contain specific nuclear proteins involved in enhancer activity. ^
Resumo:
The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
DNA binding with One Finger (DOF) transcription factors are involved in multiple aspects of plant growth and development but their precise roles in abiotic stress tolerance are largely unknown. Here we report a group of five tomato DOF genes, homologous to Arabidopsis Cycling DOF Factors (CDFs), that function as transcriptional regulators involved in responses to drought and salt stress and flowering-time control in a gene-specific manner. SlCDF1?5 are nuclear proteins that display specific binding with different affinities to canonical DNA target sequences and present diverse transcriptional activation capacities in vivo. SlCDF1?5 genes exhibited distinct diurnal expression patterns and were differentially induced in response to osmotic, salt, heat, and low-temperature stresses. Arabidopsis plants overexpressing SlCDF1 or SlCDF3 showed increased drought and salt tolerance. In addition, the expression of various stress-responsive genes, such as COR15, RD29A, and RD10, were differentially activated in the overexpressing lines. Interestingly, overexpression in Arabidopsis of SlCDF3 but not SlCDF1 promotes late flowering through modulation of the expression of flowering control genes such as CO and FT. Overall, our data connect SlCDFs to undescribed functions related to abiotic stress tolerance and flowering time through the regulation of specific target genes and an increase in particular metabolites
Resumo:
El tomate (Solanum lycopersicum L.) es considerado uno de los cultivos hortícolas de mayor importancia económica en el territorio Español. Sin embargo, su producción está seriamente afectada por condiciones ambientales adversas como, salinidad, sequía y temperaturas extremas. Para resolver los problemas que se presentan en condiciones de estrés, se han empleado una serie de técnicas culturales que disminuyen sus efectos negativos, siendo de gran interés el desarrollo de variedades tolerantes. En este sentido la obtención y análisis de plantas transgénicas, ha supuesto un avance tecnológico, que ha facilitado el estudio y la evaluación de genes seleccionados en relación con la tolerancia al estrés. Estudios recientes han mostrado que el uso de genes reguladores como factores de transcripción (FTs) es una gran herramienta para obtener nuevas variedades de tomate con mayor tolerancia a estreses abióticos. Las proteínas DOF (DNA binding with One Finger) son una familia de FTs específica de plantas (Yangisawa, 2002), que están involucrados en procesos fisiológicos exclusivos de plantas como: asimilación del nitrógeno y fijación del carbono fotosintético, germinación de semilla, metabolismo secundario y respuesta al fotoperiodo pero su preciso rol en la tolerancia a estrés abiótico se desconoce en gran parte. El trabajo descrito en esta tesis tiene como objetivo estudiar genes reguladores tipo DOF para incrementar la tolerancia a estrés abiotico tanto en especies modelo como en tomate. En el primer capítulo de esta tesis se muestra la caracterización funcional del gen CDF3 de Arabidopsis, así como su papel en la respuesta a estrés abiótico y otros procesos del desarrollo. La expresión del gen AtCDF3 es altamente inducido por sequía, temperaturas extremas, salinidad y tratamientos con ácido abscísico (ABA). La línea de inserción T-DNA cdf3-1 es más sensible al estrés por sequía y bajas temperaturas, mientras que líneas transgénicas de Arabidopsis 35S::AtCDF3 aumentan la tolerancia al estrés por sequía, osmótico y bajas temperaturas en comparación con plantas wild-type (WT). Además, estas plantas presentan un incremento en la tasa fotosintética y apertura estomática. El gen AtCDF3 se localiza en el núcleo y que muestran una unión específica al ADN con diferente afinidad a secuencias diana y presentan diversas capacidades de activación transcripcional en ensayos de protoplastos de Arabidopsis. El dominio C-terminal de AtCDF3 es esencial para esta localización y su capacidad activación, la delección de este dominio reduce la tolerancia a sequía en plantas transgénicas 35S::AtCDF3. Análisis por microarray revelan que el AtCDF3 regula un set de genes involucrados en el metabolismo del carbono y nitrógeno. Nuestros resultados demuestran que el gen AtCDF3 juega un doble papel en la regulación de la respuesta a estrés por sequía y bajas temperaturas y en el control del tiempo de floración. En el segundo capítulo de este trabajo se lleva a cabo la identificación de 34 genes Dof en tomate que se pueden clasificar en base a homología de secuencia en cuatro grupos A-D, similares a los descritos en Arabidopsis. Dentro del grupo D se han identificado cinco genes DOF que presentan características similares a los Cycling Dof Factors (CDFs) de Arabidopsis. Estos genes son considerados ortólogos de Arabidopsis CDF1-5, y han sido nombrados como Solanum lycopersicum CDFs o SlCDFs. Los SlCDF1-5 son proteínas nucleares que muestran una unión específica al ADN con diferente afinidad a secuencias diana y presentan diversas capacidades de activación transcripcional in vivo. Análisis de expresión de los genes SlCDF1-5 muestran diferentes patrones de expresión durante el día y son inducidos de forma diferente en respuesta a estrés osmótico, salino, y de altas y bajas temperaturas. Plantas de Arabidopsis que sobre-expresan SlCDF1 y SlCDF3 muestran un incremento de la tolerancia a la sequía y salinidad. Además, de la expresión de varios genes de respuesta estrés como AtCOR15, AtRD29A y AtERD10, son expresados de forma diferente en estas líneas. La sobre-expresión de SlCDF3 en Arabidopsis promueve un retardo en el tiempo de floración a través de la modulación de la expresión de genes que controlan la floración como CONSTANS (CO) y FLOWERING LOCUS T (FT). En general, nuestros datos demuestran que los SlCDFs están asociados a funciones aun no descritas, relacionadas con la tolerancia a estrés abiótico y el control del tiempo de floración a través de la regulación de genes específicos y a un aumento de metabolitos particulares. ABSTRACT Tomato (Solanum lycopersicum L.) is one of the horticultural crops of major economic importance in the Spanish territory. However, its production is being affected by adverse environmental conditions such as salinity, drought and extreme temperatures. To resolve the problems triggered by stress conditions, a number of agricultural techniques that reduce the negative effects of stress are being frequently applied. However, the development of stress tolerant varieties is of a great interest. In this direction, the technological progress in obtaining and analysis of transgenic plants facilitated the study and evaluation of selected genes in relation to stress tolerance. Recent studies have shown that a use of regulatory genes such as transcription factors (TFs) is a great tool to obtain new tomato varieties with greater tolerance to abiotic stresses. The DOF (DNA binding with One Finger) proteins form a family of plant-specific TFs (Yangisawa, 2002) that are involved in the regulation of particular plant processes such as nitrogen assimilation, photosynthetic carbon fixation, seed germination, secondary metabolism and flowering time bur their precise roles in abiotic stress tolerance are largely unknown. The work described in this thesis aims at the study of the DOF type regulatory genes to increase tolerance to abiotic stress in both model species and the tomato. In the first chapter of this thesis, we present molecular characterization of the Arabidopsis CDF3 gene as well as its role in the response to abiotic stress and in other developmental processes. AtCDF3 is highly induced by drought, extreme temperatures, salt and abscisic acid (ABA) treatments. The cdf3-1 T-DNA insertion mutant was more sensitive to drought and low temperature stresses, whereas the AtCDF3 overexpression enhanced the tolerance of transgenic plants to drought, cold and osmotic stress comparing to the wild-type (WT) plants. In addition, these plants exhibit increased photosynthesis rates and stomatal aperture. AtCDF3 is localized in the nuclear region, displays specific binding to the canonical DNA target sequences and has a transcriptional activation activity in Arabidopsis protoplast assays. In addition, the C-terminal domain of AtCDF3 is essential for its localization and activation capabilities and the deletion of this domain significantly reduces the tolerance to drought in transgenic 35S::AtCDF3 overexpressing plants. Microarray analysis revealed that AtCDF3 regulated a set of genes involved in nitrogen and carbon metabolism. Our results demonstrate that AtCDF3 plays dual roles in regulating plant responses to drought and low temperature stress and in control of flowering time in vegetative tissues. In the second chapter this work, we carried out to identification of 34 tomato DOF genes that were classified by sequence similarity into four groups A-D, similar to the situation in Arabidopsis. In the D group we have identified five DOF genes that show similar characteristics to the Cycling Dof Factors (CDFs) of Arabidopsis. These genes were considered orthologous to the Arabidopsis CDF1 - 5 and were named Solanum lycopersicum CDFs or SlCDFs. SlCDF1-5 are nuclear proteins that display specific binding to canonical DNA target sequences and have transcriptional activation capacities in vivo. Expression analysis of SlCDF1-5 genes showed distinct diurnal expression patterns and were differentially induced in response to osmotic, salt and low and high temperature stresses. Arabidopsis plants overexpressing SlCDF1 and SlCDF3 showed increased drought and salt tolerance. In addition, various stress-responsive genes, such as AtCOR15, AtRD29A and AtERD10, were expressed differently in these lines. The overexpression of SlCDF3 in Arabidopsis also results in the late flowering phenotype through the modulation of the expression of flowering control genes such CONSTANS (CO) and FLOWERING LOCUS T (FT). Overall, our data connet SlCDFs to undescribed functions related to abiotic stress tolerance and flowering time through the regulation of specific target genes and an increase in particular metabolites.
Resumo:
The BTB domain (also known as the POZ domain) is an evolutionarily conserved protein–protein interaction motif found at the N terminus of 5–10% of C2H2-type zinc-finger transcription factors, as well as in some actin-associated proteins bearing the kelch motif. Many BTB proteins are transcriptional regulators that mediate gene expression through the control of chromatin conformation. In the human promyelocytic leukemia zinc finger (PLZF) protein, the BTB domain has transcriptional repression activity, directs the protein to a nuclear punctate pattern, and interacts with components of the histone deacetylase complex. The association of the PLZF BTB domain with the histone deacetylase complex provides a mechanism of linking the transcription factor with enzymatic activities that regulate chromatin conformation. The crystal structure of the BTB domain of PLZF was determined at 1.9 Å resolution and reveals a tightly intertwined dimer with an extensive hydrophobic interface. Approximately one-quarter of the monomer surface area is involved in the dimer intermolecular contact. These features are typical of obligate homodimers, and we expect the full-length PLZF protein to exist as a branched transcription factor with two C-terminal DNA-binding regions. A surface-exposed groove lined with conserved amino acids is formed at the dimer interface, suggestive of a peptide-binding site. This groove may represent the site of interaction of the PLZF BTB domain with nuclear corepressors or other nuclear proteins.
Resumo:
We previously demonstrated that α1B-adrenergic receptor (AR) gene transcription, mRNA, and functionally coupled receptors increase during 3% O2 exposure in aorta, but not in vena cava smooth muscle cells (SMC). We report here that α1BAR mRNA also increases during hypoxia in liver and lung, but not heart and kidney. A single 2.7-kb α1BAR mRNA was detected in aorta and vena cava during normoxia and hypoxia. The α1BAR 5′ flanking region was sequenced to −2,460 (relative to ATG +1). Transient transfection experiments identify the minimal promoter region between −270 and −143 and sequence between −270 and −248 that are required for transcription of the α1BAR gene in aorta and vena cava SMC during normoxia and hypoxia. An ATTAAA motif within this sequence specifically binds aorta, vena cava, and DDT1MF-2 nuclear proteins, and transcription primarily initiates downstream of this motif at approximately −160 in aorta SMC. Sequence between −837 and −273 conferred strong hypoxic induction of transcription in aorta, but not in vena cava SMC, whereas the cis-element for the transcription factor, hypoxia-inducible factor 1, conferred hypoxia-induced transcription in both aorta and vena cava SMC. These data identify sequence required for transcription of the α1BAR gene in vascular SMC and suggest the atypical TATA-box, ATTAAA, may mediate this transcription. Hypoxia-sensitive regions of the α1BAR gene also were identified that may confer the differential hypoxic increase in α1BAR gene transcription in aorta, but not in vena cava SMC.
Resumo:
ATRX is a member of the SNF2 family of helicase/ATPases that is thought to regulate gene expression via an effect on chromatin structure and/or function. Mutations in the hATRX gene cause severe syndromal mental retardation associated with α-thalassemia. Using indirect immunofluorescence and confocal microscopy we have shown that ATRX protein is associated with pericentromeric heterochromatin during interphase and mitosis. By coimmunofluorescence, ATRX localizes with a mouse homologue of the Drosophila heterochromatic protein HP1 in vivo, consistent with a previous two-hybrid screen identifying this interaction. From the analysis of a trap assay for nuclear proteins, we have shown that the localization of ATRX to heterochromatin is encoded by its N-terminal region, which contains a conserved plant homeodomain-like finger and a coiled-coil domain. In addition to its association with heterochromatin, at metaphase ATRX clearly binds to the short arms of human acrocentric chromosomes, where the arrays of ribosomal DNA are located. The unexpected association of a putative transcriptional regulator with highly repetitive DNA provides a potential explanation for the variability in phenotype of patients with identical mutations in the ATRX gene.