133 resultados para Amilase
Resumo:
2006
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
This paper discusses the inducer effect of corn soluble starch and the individual components (amylose and amylopectin) from corn and potatoes starch for alpha-amylase production by a strain of Rhizopus sp. The following decreasing order in the enzyme production was obtained: corn amylose > potatoes amylose > corn amylopectin > potatoes amylopectin > starch > maltose, coinciding with the ability of the enzyme to release reducing units, except the soluble starch that was more softly hydrolysed. However, when the enzyme action was measured by the iodine binding method, an inverse order of enzyme activity was obtained, that is: amylopectins > starch > amylosis. The results suggest that: a) branched structures in substrate affect the enzyme production; b) corn amylose and corn amylopectin are better inducers than their respectives homologous from potatoes; c) cc-amylase from Rhizopus sp has different action patterns on substrates with straight or branched chains: from the former, it removes only reducing units with lower molecular weight (G1-G3); from the latter it also removes oligosaccharides with higher molecular weight (G5-G6).
Resumo:
A study was carried out, on both sexes, to determine the effects of chlorpropamide (DIABINESE) and glibenclamide (DAONIL) on patients with Type II diabetes using as metabolic parameters the following serum: glucose, amilase, high density lipoprotein cholesterol, free fatty acids. The results indicated that both drugs were potentially similar in relation to glycemia, high density lipoprotein cholesterol, and free fatty acids, in both sexes. Chlorpropamide was significantly more effective in reducing amilase activity in male diabetics than glibenclamide. The above mentioned hypoglycemiants did not reduce glycemia to basic levels in either masculine or feminine groups of diabetics.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Eryngium foetidum L., Eryngium cf. campestre and Coriandrum sativum L. are Apiaceae family vegetable appreciated due to its peculiar flavor and consumed mainly in the north and northeast of Brazil. The vegetables are rich in protein, vitamins, fiber, minerals, total phenolics and other essential bioactives for a balanced health. Nevertheless, many vegetables are falling into disuse by the population, instead of processed foods. The rescue consumption of these species is very important, aiming at their nutritional, therapeutic and antioxidant benefits. In this study, was quantified the levels of total phenolic, flavonoids and dihidroflavonoides by molecular absorption spectrophotometry in the ultraviolet. The total antioxidant capacity was also evaluated using five methodologies of in vitro assays: test Total Antioxidant Capacity (TAC), scavenging of DPPH and ABTS radical, Power Reducing and Power Chelating. It was also evaluated the power inhibitor of α-amylase and lipoxygenase extracts. All species showed significant levels of total phenolics, flavonoids and dihidroflavonoides in its composition. All treatments showed antioxidant activity of 50% except the sheets of E. cf. campestre, C. sativum and bracts of E. foetidum in DPPH and bracts of E. foetidum in ABTS. All treatments also exhibited 50% inhibition activity of the enzyme lipoxygenase.In α-amylase only the leaves of E. cf. campestre and C. sativum showed IC50. It was evaluate the phytochemical composition, aiming to meet the nutritional potential of Apiaceae family vegetables, called unconventional: Eryngium foetidum L., Eryngium cf. campestre; and conventional: Coriandrum sativum L. At the centesimal composition analysis Coriandrum sativum L. presented the highest levels of protein. The leaves of Eryngium foetidum L. exhibited higher values than other species in dietary fiber, while Eryngium cf. campestre detach with superior results in lipids. About the analyzed minerals, the leaves of Eryngium cf. campestre expressed results superior to the other in N, Ca, Mg, S and Cu. The amount of iron highlighted in sheets of E. foetidum, whereas P, K, Mn, Zn and B were most significant on leaves of C. sativum. It was concluded that the levels of total phenolic compounds found in these vegetables, characterize them for its high potential in the antioxidant and inhibition of lipoxygenase and α-amylase enzymes. Their protein and mineral levels classify them as species that can be used as a nutritional source in the preparation of other foods and may their regular consumption bring benefit to human health.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Ciência Odontólogica - FOA
Resumo:
Amilases e proteases constituem um dos principais grupos de enzimas industriais pelo seu amplo espectro de aplicações biotecnológicas. Elas podem ser obtidas a partir de fontes microbianas e com altos rendimentos por processos de fermentação em estado sólido (FES). Conhecer as características bioquímicas das enzimas é fundamental para adequação aos processos industriais. O objetivo do trabalho foi determinar a melhor temperatura para atividade das enzimas amilase e protease de Rhizopus oligosporus obtidas por fermentação em estado sólido utilizando farelo de trigo como substrato. Os melhores valores para atividade amilolítica e proteolítica foram obtidos nas temperaturas de 55 - 65 °C e de 50 - 60 °C, respectivamente. Estes resultados sugerem que as enzimas estudadas podem ser utilizadas em processos que empregam elevadas temperaturas.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
A thermotolerant strain of Rhizopus oryzae was grown in three agro-industrial by-products: brewers’ rice, corn grits and wheat bran. Different substrates, cultivation time, moisture content, additional nitrogen sources, pH and temperature of incubation were evaluated aiming to optimize growing conditions. The highest enzymatic activity was observed after 24 h of cultivation using wheat bran as substrate with the following salt solutions: NH4NO3, MgSO4.7H2O and (NH4)2SO4 0.1% at temperature of 35°C. It was observed that changes in the pH range 4.0-6.0 did not significantly affect α-amylase activity. The optimum operation conditions were 75°C and pH 4.5. The enzymes remained stable at 75°C in the absence of substrate for 25 min.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
2016
Resumo:
Este trabalho teve o objetivo de estudar o efeito de medicamentos com diferentes ações agonista PPAR (rosiglitazona, fenofibrato e bezafibrato) sobre o perfil lipídico, glicídico e alterações na massa corporal e morfologia do tecido adiposo e pancreático em modelo de diabetes e sobrepeso induzido por dieta. Camundongos C57BL/6 (2 meses de idade) foram alimentados com dieta padrão (SC, n=10) ou dieta hiperlipídica rica em sacarose (HFHS, n=40) por 6 semanas. Logo após, os animais HFHS foram subdividos em: HFHS não tratado e HFHS tratado com rosiglitazona (HFHS-Ro), fenofibrato (HFHS-Fe) ou bezafibrato (HFHS-Bz) (5 semanas). Os camundongos alimentados com dieta HFHS apresentaram maior glicemia e insulina de jejum (+33% e +138%, respectivamente), intolerância à glicose, resistência à insulina, aumento da massa corporal (MC) (+20%) e adiposidade, hipertrofia de adipócitos e redução da imunocoloração para adiponectina no tecido adiposo. No pâncreas houve aumento da massa (+28%), acúmulo de gordura (+700%), hipertrofia da ilhota (+38%) e redução da imunocoloração para GLUT-2 (-60%). A rosiglitazona diminuiu a glicemia e insulina de jejum, porém induziu o ganho de MC e hipertrofia cardíaca. O fenofibrato estabilizou a MC, enquanto o bezafibrato levou a perda de MC. Apenas o bezafibrato impediu a hipertrofia da ilhota. A imunocoloração para GLUT-2 foi aumentada por todos os medicamentos, e não houve alterações na imunocoloração para o PPARα. Sinais morfológicos de pancreatite foram vistos no grupo HFHS-Fe, apesar dos níveis normais de amilase e lipase séricos. A rosiglitazona exacerbou a infiltração intrapancreática de gordura (+75% vs. HFHS), e o bezafibrato aumento a imunocoloração para o PPARβ/δ nas ilhotas pancreáticas. Em conclusão, o bezafibrato apresentou um efeito mais amplo sobre as alterações metabólicas, morfológicas e biométricas decorrentes da dieta HFHS, sugerindo que a inibição das três isoformas do PPAR seria melhor do que a inibição de apenas uma isoforma. A rosiglitazona exacerbou o ganho de MC, a infiltração de gordura no pâncreas e induziu hipertrofia cardíaca, assim, é necessário cautela ao prescrever este medicamento a um paciente obeso.