962 resultados para single stranded DNA
Resumo:
Tetracapsuloides bryosalmonae is the myxozoan parasite causing proliferative kidney disease (PKD) of salmonid fishes in Europe and North America. The complete life cycle of the parasite remains unknown despite recent discoveries that the stages infectious for fish develop in freshwater bryozoans. During the course of examinations of the urine of rainbow trout (Oncorhynchus mykiss) with or recovering from PKD we identified spores with features similar to those of T. bryosalmonae found in the bryozoan host. Spores found in the urine were subspherical, with a width of 16 mum and height of 14 mum, and possessed two soft valves surrounding two spherical polar capsules (2 mum in diameter) and a single sporoplasm. The absence of hardened valves is a distinguishing characteristic of the newly established class Malacosporea that includes T. bryosalmonae as found in the bryozoan host. The parasite in the urine of rainbow trout possessed only two polar capsules and two valve cells compared to the four polar capsules and four valves observed in the spherical spores of 19 mum in diameter from T. bryosalmonae from the bryozoan host. Despite morphological differences, a relationship between the spores in the urine of rainbow trout and T. bryosalmonae was demonstrated by binding of monoclonal and polyclonal antibodies and DNA probes specific to T. bryosalmonae.
Resumo:
In mammalian cells, DNA ligase IIIalpha and DNA ligase I participate in the short- and long-patch base excision repair pathways, respectively. Using an in vitro repair assay employing DNA ligase-depleted cell extracts and DNA substrates containing a single lesion repaired either through short-patch (regular abasic site) or long-patch (reduced abasic site) base excision repair pathways, we addressed the question whether DNA ligases are specific to each pathway or if they are exchangeable. We find that immunodepletion of DNA ligase I did not affect the short-patch repair pathway but blocked long-patch repair, suggesting that DNA ligase IIIa is not able to substitute DNA ligase I during long-patch repair. In contrast, immunodepletion of DNA ligase IIIa did not significantly affect either pathway. Moreover, repair of normal abasic sites in wild-type and X-ray cross-complementing gene 1 (XRCC1)-DNA ligase IIIalpha-immunodepleted cell extracts involved similar proportions of short- and long-patch repair events. This suggests that DNA ligase I was able to efficiently substitute the XRCC1-DNA ligase IIIa complex during short-patch repair.
Resumo:
Background: Cruciferous vegetable (CV) consumption is associated with a reduced risk of several cancers in epidemiologic studies. Objective: The aim of this study was to determine the effects of watercress (a CV) supplementation on biomarkers related to cancer risk in healthy adults. Design: A single-blind, randomized, crossover study was conducted in 30 men and 30 women (30 smokers and 30 nonsmokers) with a mean age of 33 y (range: 19-55 y). The subjects were fed 85 g raw watercress daily for 8 wk in addition to their habitual diet. The effect of supplementation was measured on a range of endpoints, including DNA damage in lymphocytes (with the comet assay), activity of detoxifying enzymes (glutathione peroxidase and superoxide dismutase) in erythrocytes, plasma antioxidants (retinol, ascorbic acid, a-tocopherol, lutein, and beta-carotene), plasma total antioxidant status with the use of the ferric reducing ability of plasma assay, and plasma lipid profile. Results: Watercress supplementation (active compared with control phase) was associated with reductions in basal DNA damage (by 17%; P = 0.03), in basal plus oxidative purine DNA damage (by 23.9%; P = 0.002), and in basal DNA damage in response to ex vivo hydrogen peroxide challenge (by 9.4%; P = 0.07). Beneficial changes seen after watercress intervention were greater and more significant in smokers than in nonsmokers. Plasma lutein and P-carotene increased significantly by 100% and 33% (P < 0.001), respectively, after watercress supplementation. Conclusion: The results support the theory that consumption of watercress can be linked to a reduced risk of cancer via decreased damage to DNA and possible modulation of antioxidant status by increasing carotenoid concentrations.
Resumo:
Mitochondrial DNA (mtDNA) mutations are an important cause of genetic disease and have been proposed to play a role in the ageing process. Quantification of total mtDNA mutation load in ageing tissues is difficult as mutational events are rare in a background of wild-type molecules, and detection of individual mutated molecules is beyond the sensitivity of most sequencing based techniques. The methods currently most commonly used to document the incidence of mtDNA point mutations in ageing include post-PCR cloning, single-molecule PCR and the random mutation capture assay. The mtDNA mutation load obtained by these different techniques varies by orders of magnitude, but direct comparison of the three techniques on the same ageing human tissue has not been performed. We assess the procedures and practicalities involved in each of these three assays and discuss the results obtained by investigation of mutation loads in colonic mucosal biopsies from ten human subjects.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
A sample of 10 Norway rats (Rattus norvegicus) was taken for DNA resistance testing from an agricultural site in Kent where applications of the anticoagulant rodenticide bromadiolone had been unsuccessful. All animals tested were homozygous for the single nucleotide VKORC1 polymorphism tyrosine139phenylalanine, or Y139F. This is a common resistance mutation found extensively in France and Belgium but not previously in the UK. Y139F confers a significant level of resistance to first-generation anticoagulants, such as chlorophacinone, and to the second-generation compound bromadiolone. Another compound widely used in the UK, difenacoum, is also thought to be partially resisted by rats which carry Y139F. A silent VKORC1 mutation was also found in all rats tested. The presence of a third important VKORC1 mutation which confers resistance to anticoagulant rodenticides in widespread use in the UK, the others being Y139C and L120Q, further threatens the ability of pest control practitioners to deliver effective rodent control.
Resumo:
Previous analyses of Australian samples have suggested that populations of the same broad racial group (Caucasian, Asian, Aboriginal) tend to be genetically similar across states. This suggests that a single national Australian database for each such group may be feasible, which would greatly facilitate casework. We have investigated samples drawn from each of these groups in different Australian states, and have quantified the genetic homogeneity across states within each racial group in terms of the "coancestry coefficient" F(ST). In accord with earlier results, we find that F(ST) values, as estimated from these data, are very small for Caucasians and Asians, usually <0.5%. We find that "declared" Aborigines (which includes many with partly Aboriginal genetic heritage) are also genetically similar across states, although they display some differentiation from a "pure" Aboriginal population (almost entirely of Aboriginal genetic heritage).
Resumo:
We report the single-crystal X-ray structure for the complex of the bisacridine bis-(9-aminooctyl(2-(dimethylaminoethyl)acridine-4-carboxamide)) with the oligonucleotide d(CGTACG)2 to a resolution of 2.4 Å. Solution studies with closed circular DNA show this compound to be a bisintercalating threading agent, but so far we have no crystallographic or NMR structural data conforming to the model of contiguous intercalation within the same duplex. Here, with the hexameric duplex d(CGTACG), the DNA is observed to undergo a terminal cytosine base exchange to yield an unusual guanine quadruplex intercalation site through which the bisacridine threads its octamethylene linker to fuse two DNA duplexes. The 4-carboxamide side-chains form anchoring hydrogen-bonding interactions with guanine O6 atoms on each side of the quadruplex. This higher-order DNA structure provides insight into an unexpected property of bisintercalating threading agents, and suggests the idea of targeting such compounds specifically at four-way DNA junctions.
Resumo:
DNA-strand exchange is a vital step in the recombination process, of which a key intermediate is the four-way DNA Holliday junction formed transiently in most living organisms. Here, the single-crystal structure at a resolution of 2.35 Å of such a DNA junction formed by d(CCGGTACCGG)2, which has crystallized in a more highly symmetrical packing mode to that previously observed for the same sequence, is presented. In this case, the structure is isomorphous to the mismatch sequence d(CCGGGACCGG)2, which reveals the roles of both lattice and DNA sequence in determining the junction geometry. The helices cross at the larger angle of 43.0° (the previously observed angle for this sequence was 41.4°) as a right-handed X. No metal cations were observed; the crystals were grown in the presence of only group I counter-cations.
Resumo:
A four-wavelength MAD experiment on a new brominated octanucleotide is reported here. d[ACGTACG(5-BrU)], C77H81BrN30O32P7, (DNA) = 2235, tetragonal, P43212 (No. 96), a = 43.597, c = 26.268 Å, V = 49927.5 Å3, Z = 8, T = 100 K, R = 10.91% for 4312 reflections between 15.0 and 1.46 Å resolution. The self-complementary brominated octanucleotide d[ACGTACG(5-BrU)]2 has been crystallized and data measured to 1.45 Å at both 293 K and a second crystal flash frozen at 100 K. The latter data collection was carried out to the same resolution at the four wavelengths 0.9344, 0.9216, 0.9208 and 0.9003 Å, around the Br K edge at 0.92 Å and the structure determined from a map derived from a MAD data analysis using pseudo-MIR methodology, as implemented in the program MLPHARE. This is one of the first successful MAD phasing experiments carried out at Sincrotrone Elettra in Trieste, Italy. The structure was refined using the data measured at 0.9003 Å, anisotropic temperature factors and the restrained least-squares refinement implemented in the program SHELX96, and the helical parameters are compared with those previously determined for the isomorphous d(ACGTACGT)2 analogue. The asymmetric unit consists of a single strand of octamer with 96 water molecules. No countercations were located. The A-DNA helix geometry obtained has been analysed using the CURVES program.
Resumo:
d(ACGTACGT), C78H84N30O32P7.20H2O, Mr (DNA) = 2170, tetragonal, P43212 (No 96), a = 42.845 (1), b = 42.845(1), c = 24.804 (1) Å, V = 45532.5 (2) Å3, z = 8,(MoK) = 0.71069 Å,µ(MoK) = 0.10 mm-1, T = 295 K, R = 0.18 for 1994 unique reflections between 5.0 and 1.9 Å resolution. The self-complementary octanucleotide d(ACGTACGT)2 has been crystallized and its structure determined to a resolution of 1.9 Å. The asymmetric unit consists of a single strand of octamer with 20 water molecules. It is only the second example of an octanucleotide having terminal A·T base pairs whose structure has been determined by X-ray crystallography. The sequence adopts the modified A-type conformation found for all octanucleotide duplexes studied to date with the helix bent by approximately 15° and an average tilt angle of 0°. Unusually the data collection was carried out using a 3 kW molybdenum sealed-tube source. The conformational details are discussed in comparison with other closely related sequences.
Resumo:
Mitochondrial DNA (mtDNA) mutations are an important cause of genetic disease and have been proposed to play a role in the ageing process. Quantification of total mtDNA mutation load in ageing tissues is difficult as mutational events are rare in a background of wild-type molecules, and detection of individual mutated molecules is beyond the sensitivity of most sequencing based techniques. The methods currently most commonly used to document the incidence of mtDNA point mutations in ageing include post-PCR cloning, single-molecule PCR and the random mutation capture assay. The mtDNA mutation load obtained by these different techniques varies by orders of magnitude, but direct comparison of the three techniques on the same ageing human tissue has not been performed. We assess the procedures and practicalities involved in each of these three assays and discuss the results obtained by investigation of mutation loads in colonic mucosal biopsies from ten human subjects.
Resumo:
3 '-S-Phosphorothiolate linkages incorporated into an oligodeoxynucleotide have been shown to stabilise duplex formation with a complementary RNA strand, but destabilise a duplex formed with a complementary DNA strand. The four-stranded i-motif structure is also stabilised this modification.
Resumo:
Small interfering RNA (siRNA), antisense oligonucleotides (ODNs), ribozymes and DNAzymes have emerged as sequence-specific inhibitors of gene expression that may have therapeutic potential in the treatment of a wide range of diseases. Due to their rapid degradation in vivo, the efficacy of naked gene silencing nucleic acids is relatively short lived. The entrapment of these nucleic acids within biodegradable sustained-release delivery systems may improve their stability and reduce the doses required for efficacy. In this study, we have evaluated the potential in vitro and in vivo use of biodegradable poly (d,l-lactide-co-glycolide) copolymer (PLGA) microspheres as sustained delivery devices for ODNs, ribozyme, siRNA and DNA enzymes. In addition, we investigated the release of ODN conjugates bearing 5′-end lipophilic groups. The in vitro sustained release profiles of microsphere-entrapped nucleic acids were dependent on variables such as the type of nucleic acid used, the nature of the lipophilic group, and whether the nucleic acid used was single or double stranded. For in vivo studies, whole body autoradiography was used to monitor the bio-distribution of either free tritium-labelled ODN or that entrapped within PLGA microspheres following subcutaneous administration in Balb-c mice. The majority of the radioactivity associated with free ODN was eliminated within 24 h whereas polymer-released ODN persisted in organs and at the site of administration even after seven days post-administration. Polymer microsphere released ODN exhibited a similar tissue and cellular tropism to the free ODN. Micro-autoradiography analyses of the liver and kidneys showed similar bio-distribution for polymer-released and free ODNs with the majority of radioactivity being concentrated in the proximal convoluted tubules of the kidney and in the Kupffer cells of the liver. These findings suggest that biodegradable PLGA microspheres offer a method for improving the in vivo sustained delivery of gene silencing nucleic acids, and hence are worthy of further investigation as delivery systems for these macromolecules.
Resumo:
Six strains of lactic acid producing bacteria (LAB) were incubated (1 x 10(8)cfu/ml) with genotoxic faecal water from a human subject. HT29 human adenocarcinoma cells were then challenged with the resultant samples and DNA damage measured using the single cell gel electrophoresis (comet) assay. The LAB strains investigated were Bifidobacterium sp. 420, Bifidobacterium Bb12, Lactobacillus plantarum, Streptococcus thermophilus, Lactobacillus bulgaricus and Enterococcus faecium. DNA damage was significantly decreased by all bacteria used with the exception of Strep. thermophilus. Bif. Bb12 and Lact. plantarum showed the greatest protective effect against DNA damage. Incubation of faecal water with different concentrations of Bif. Bb12 and Lact. plantarum revealed that the decrease in genotoxicity was related to cell density. Non-viable (heat treated) probiotic cells had no effect on faecal water genotoxicity. In a second study, HT29 cells were cultured in the presence of supernatants of incubations of probiotics with various carbohydrates including known prebiotics; the HT29 cells were then exposed to faecal water. Overall, incubations involving Lact. plantarum with the fructooligosaccharide (FOS)-based prebiotics Inulin, Raftiline, Raftilose and Actilight were the most effective in increasing the cellular resistance to faecal water genotoxicity, whereas fermentations with Elixor (a galactooligosaccharide) and Fibersol (a maltodextrin) were less effective. Substantial reductions in faecal water-induced DNA damage were also seen with supernatants from incubation of prebiotics with Bif. Bb12. The supernatant of fermentations involving Ent. faecium and Bif. sp. 420 generally had less potent effects on genotoxicity although some reductions with Raftiline and Elixor fermentations were apparent.