956 resultados para Dna-sequence
Resumo:
DNaseI footprinting is an established assay for identifying transcription factor (TF)-DNA interactions with single base pair resolution. High-throughput DNase-seq assays have recently been used to detect in vivo DNase footprints across the genome. Multiple computational approaches have been developed to identify DNase-seq footprints as predictors of TF binding. However, recent studies have pointed to a substantial cleavage bias of DNase and its negative impact on predictive performance of footprinting. To assess the potential for using DNase-seq to identify individual binding sites, we performed DNase-seq on deproteinized genomic DNA and determined sequence cleavage bias. This allowed us to build bias corrected and TF-specific footprint models. The predictive performance of these models demonstrated that predicted footprints corresponded to high-confidence TF-DNA interactions. DNase-seq footprints were absent under a fraction of ChIP-seq peaks, which we show to be indicative of weaker binding, indirect TF-DNA interactions or possible ChIP artifacts. The modeling approach was also able to detect variation in the consensus motifs that TFs bind to. Finally, cell type specific footprints were detected within DNase hypersensitive sites that are present in multiple cell types, further supporting that footprints can identify changes in TF binding that are not detectable using other strategies.
Resumo:
This work shows that the proximal promoter of the mouse Afp gene contains a Ku binding site and that Ku binding is associated with down-regulation of the transcriptional activity of the Afp promoter. The Ku binding site is located in a segment able to adopt a peculiar structured form, probably a hairpin structure. Interestingly, the structured form eliminates the binding sites of the positive transcription factor HNF1. Furthermore, a DNAse hypersensitive site is detected in footprinting experiments done with extracts of AFP non-expressing hepatoma cells. These observations suggest that the structured form is stabilised by Ku and is associated with extinction of the gene in AFP non-expressing hepatic cells.
Resumo:
Two 17-mer oligodeoxynucleotide-5'-linked-(6,7-diphenylpterin) conjugates, 2 and 3, were prepared as photosensitisers for targeting photooxidative damage to a 34-mer DNA oligodeoxynucleotide (ODN) fragment 1 representing the chimeric bcr-abl gene that is implicated in the pathogenesis of chronic myeloid leukaemia (CML). The base sequence in the 17-mer was 3'G G T A G T T A T T C C T T C T T5'. In the first of these ODN conjugates (2) the pterin was attached at its N3 atom, via a -(CH2)3OPO(OH)- linker, to the 5'-OH group of the ODN. Conjugate 2 was prepared from 2-amino-3-(3-hydroxypropyl)-6,7-diphenyl-4(3H)-pteridinone 10, using phosphoramidite methodology. Starting material 10 was prepared from 5-amino-7-methylthiofurazano[3,4-d]pyrimidine 4 via an unusual highly resonance stabilised cation 8, incorporating the rare 2H,6H-pyrimido[6,1-b][1,3]oxazine ring system. In the characterisation of 10 two pteridine phosphazenes, 15 and 29, were obtained, as well as new products containing two uncommon tricyclic ring systems, namely pyrimido[2,1-b]pteridine (20 and 24) and pyrimido[1,2-c]pteridine (27). In the second ODN conjugate the linker was -(CH2)5CONH(CH2)6OPO(OH)- and was attached to the 2-amino group of the pterin. In the preparation of 3, the N-hydroxysuccinimide ester 37 of 2-(5-carboxypentylamino)-6,7-diphenyl-4(3H)-pteridinone was condensed with the hexylamino-modified 17-mer. Excitation of 36 with near UV light in the presence of the single-stranded target 34-mer, 5'T G A C C A T C A A T A A G14 G A A G18 A A G21 C C C T T C A G C G G C C3' 1 caused oxidative damage at guanine bases, leading to alkali-labile sites which were monitored by polyacrylamide gel electrophoresis. Cleavage was observed at all guanine sites with a marked preference for cleavage at G14. In contrast, excitation of ODN-pteridine conjugate 2 in the presence of 1 caused oxidation of the latter predominantly at G18, with a smaller extent of cleavage at G15 and G14 (in the double-stranded portion) and G21. These results contrast with our previous observation of specific cleavage at G21 with ruthenium polypyridyl sensitisers, and suggest that a different mechanism, probably one involving Type 1 photochemical electron transfer, is operative. Much lower yields were found with the ODN-pteridine conjugate 3, perhaps as a consequence of the longer linker between the ODN and the pteridine in this case.
Resumo:
Small 1,000-bp fragments of genomic DNA obtained from human malignant breast cancer cell lines when transfected into a benign rat mammary cell line enhance transcription of the osteopontin gene and thereby cause the cells to metastasize in syngeneic rats. To identify the molecular events underlying this process, transient cotransfections of an osteopontin promoter-reporter construct and fragments of one metastasis-inducing DNA (Met-DNA) have identified the active components in the Met-DNA as the binding sites for the T-cell factor (Tcf) family of transcription factors. Incubation of cell extracts with active DNA fragments containing the sequence CAAAG caused retardation of their mobilities on polyacrylamide gels, and Western blotting identified Tcf-4, beta-catenin, and E-cadherin in the relevant DNA complexes in vitro. Transfection of an expression vector for Tcf-4 inhibited the stimulated activity of the osteopontin promoter-reporter construct caused by transiently transfected active fragments of Met-DNA or permanently transfected Met-DNA. This stimulated activity of the osteopontin promoter-reporter construct is accompanied by an increase in endogenous osteopontin mRNA but not in fos or actin mRNAs in the transfected cells. Permanent transfection of the benign rat mammary cell line with a 20-bp fragment from the Met-DNA containing the Tcf recognition sequence CAAAG caused an enhanced permanent production of endogenous osteopontin protein in vitro and induced the cells to metastasize in syngeneic rats in vivo. The corresponding fragment without the CAAAG sequence was without either effect. Therefore, the regulatory effect of the C9-Met-DNA is exerted, at least in part, by a CAAAG sequence that can sequester the endogenous inhibitory Tcf-4 and thereby promote transcription of osteopontin, the direct effector of metastasis in this system.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.
Resumo:
Expansion of trinucleotide repeat DNA of the classes CAG�·CTG, CGG�·CCG and GAA�·TTC are found to be associated with several neurodegenerative disorders. Different mechanisms have been attributed to the expansion of triplets, mainly involving the formation of alternate secondary structures by such repeats. This paper reports the molecular dynamics simulation of triplet repeat DNA sequences to study the basic structural features of DNA that are responsible for the formation of structures such as hairpins and slip-strand DNA leading to expansion. All the triplet repeat sequences studied were found to be more flexible compared to the control sequence unassociated with disease. Moreover, flexibility was found to be in the order CAG�·CTG > CGG�·CCG = GAA�·TTC, the highly flexible CAG�·CTG repeat being the most common cause of neurodegenerative disorders. In another simulation, a single G�·C to T�·A mutation at the 9th position of the CAG�·CTG repeat exhibited a reduction in bending compared to the pure 15-mer CAGâ�¢CTG repeat. EPM1 dodecamer repeat associated with the pathogenesis of progressive myoclonus epilepsy was also simulated and showed flexible nature suggesting a similar expansion mechanism.
Resumo:
A novel anthracene-tagged oligonucleotide can discriminate between a fully-matched DNA target sequence and one with a single mismatching base-pair through a remarkable difference in fluorescence emission intensity upon duplex formation.
Resumo:
Background: DNA ligases catalyse phosphodiester bond formation between adjacent bases in nicked DNA, thereby sealing the nick. A key step in the catalytic mechanism is the formation of an adenylated DNA intermediate. The adenyl group is derived from either ATP (in eucaryotes and archaea) or NAD+4 (in bacteria). This difference in cofactor specificity suggests that DNA ligase may be a useful antibiotic target.
Results: The crystal structure of the adenylation domain of the NAD+-dependent DNA ligase from Bacillus stearothermophilus has been determined at 2.8 Å resolution. Despite a complete lack of detectable sequence similarity, the fold of the central core of this domain shares homology with the equivalent region of ATP-dependent DNA ligases, providing strong evidence for the location of the NAD+-binding site.
Conclusions: Comparison of the structure of the NAD+4-dependent DNA ligase with that of ATP-dependent ligases and mRNA-capping enzymes demonstrates the manifold utilisation of a conserved nucleotidyltransferase domain within this family of enzymes. Whilst this conserved core domain retains a common mode of nucleotide binding and activation, it is the additional domains at the N terminus and/or the C terminus that provide the alternative specificities and functionalities in the different members of this enzyme superfamily.
Resumo:
With the advent of 'ancient DNA' studies on preserved material of extant and extinct species, museums and herbaria now represent an important although still underutilized resource in molecular ecology. The ability to obtain sequence data from archived specimens can reveal the recent history of cryptic species and introductions. We have analysed extant and herbarium samples of the highly invasive green alga Codium fragile, many over 100 years old, to identify cryptic accessions of the invasive strain known as C. fragile ssp. tomentosoides, which can be identified by a unique haplotype. Molecular characterization of specimens previously identified as native in various regions shows that the invasive tomentosoides strain has been colonizing new habitats across the world for longer than records indicate, in some cases nearly 100 years before it was noticed. It can now be found in the ranges of all the other native haplotypes detected, several of which correspond to recognized subspecies. Within regions in the southern hemisphere there was a greater diversity of haplotypes than in the northern hemisphere, probably as a result of dispersal by the Antarctic Circumpolar Current. The findings of this study highlight the importance of herbaria in preserving contemporaneous records of invasions as they occur, especially when invasive taxa are cryptic.
Resumo:
Cryptic species diversity is thought to be common within the class Insecta, posing problems for basic ecological and population genetic studies and conservation management. Within the temperate bumble bee (Bombus spp.) fauna, members of the subgenus Bombus sensu stricto are amongst the most abundant and widespread. However, their species diversity is controversial due to the extreme difficulty or inability morphologically to identify the majority of individuals to species. Our character-based phylogenetic analyses of partial CO1 (700 bp) from 39 individuals spread across their sympatric European ranges provided unequivocal support for five taxa (3-22 diagnostic DNA base pair sites per species). Inclusion of 20 Irish specimens to the dataset revealed >= 2.3% sequence divergence between taxa and 200 m) whilst B. cryptarum was relatively more abundant at higher altitudes. Bombus magnus was rarely encountered at urban sites. Both B. lucorum and B. terrestris are nowadays reared commercially for pollination and transported globally. Our RFLP approach to identify native fauna can underpin ecological studies of these important cryptic species as well as the impact of commercial bumble bees on them.
Resumo:
Despite the potential model role of the green algal genus Codium for studies of marine speciation and evolution, there have been difficulties with species delimitation and a molecular phylogenetic framework was lacking. In the present study, 74 evolutionarily significant units (ESUs) are delimited using 227 rbcL exon 1 sequences obtained from specimens collected throughout the genus' range. Several morpho-species were shown to be poorly defined, with some clearly in need of lumping and others containing pseudo-cryptic diversity. A phylogenetic hypothesis of 72 Codium ESUs is inferred from rbcL exon 1 and rps3-rp/16 sequence data using a conventional nucleotide substitution model (GTR + Gamma + I), a codon position model and a covariotide (covarion) model, and the fit of a multitude of substitution models and alignment partitioning strategies to the sequence data is reported. Molecular clock tree rooting was carried out because out-group rooting was probably affected by phylogenetic bias. Several aspects of the evolution of morphological features of Codium are discussed and the inferred phylogenetic hypothesis is used as a framework to study the biogeography of the genus, both at a global scale and within the Indian Ocean. (c) 2007 Elsevier Inc. All rights reserved.
Resumo:
BACKGROUND:
The genetic heterogeneity of many Mendelian disorders, such as retinitis pigmentosa which results from mutations in over 40 genes, is a major obstacle to obtaining a molecular diagnosis in clinical practice. Targeted high-throughput DNA sequencing offers a potential solution and was used to develop a molecular diagnostic screen for patients with retinitis pigmentosa.
METHODS:
A custom sequence capture array was designed to target the coding regions of all known retinitis pigmentosa genes and used to enrich these sequences from DNA samples of five patients. Enriched DNA was subjected to high-throughput sequencing singly or in pools, and sequence variants were identified by alignment of up to 10 million reads per sample to the normal reference sequence. Potential pathogenicity was assessed by functional predictions and frequency in controls.
RESULTS AND CONCLUSIONS:
Known homozygous PDE6B and compound heterozygous CRB1 mutations were detected in two patients. A novel homozygous missense mutation (c.2957A?T; p.N986I) in the cyclic nucleotide gated channel ß1 (CNGB1) gene predicted to have a deleterious effect and absent in 720 control chromosomes was detected in one case in which conventional genetic screening had failed to detect mutations. The detection of known and novel retinitis pigmentosa mutations in this study establishes high-throughput DNA sequencing with DNA pooling as an effective diagnostic tool for heterogeneous genetic diseases.
Resumo:
We have developed a novel Multilocus Sequence Typing Scheme (MLST) and database (http://pubmlst.org/pacnes/) for Propionibacterium acnes based on the analysis of seven core housekeeping genes. The scheme, which was validated against previously described antibody, single locus and Random Amplification of Polymorphic DNA (RAPD) typing methods, displayed excellent resolution and differentiated 123 isolates into 37 sequence types (ST). An overall clonal population structure was detected with six eBURST groups representing the major clades I, II and III, along with two singletons. Two highly successful and global clonal lineages, ST6 (type IA) and ST10 (type IB1), representing 65% of this current MLST isolate collection were identified. The ST6 clone and closely related single locus variants (SLV), which comprise a large clonal complex CC6, dominated isolates from patients with acne, and were also significantly associated with ophthalmic infections. Our data therefore supports an association between acne and P. acnes strains from the type IA cluster and highlights the role of a widely disseminated clonal genotype in this condition. Characterisation of type I cell surface-associated antigens that are not detected in ST10 or strains of type II and III identified two dermatan-sulphate-binding proteins with putative phase/antigenic variation signatures. We propose that the expression of these proteins by type IA organisms contributes to their role in the pathophysiology of acne and helps explain the recurrent nature of the disease. The MLST scheme and database described in this study should provide a valuable platform for future epidemiological and evolutionary studies of P. acnes.
Resumo:
Erythrocytosis arises from a variety of pathogenic mechanisms. We sequenced a 256-bp region 3' to the erythropoietin (Epo) gene which included a 24- to 50-bp minimal hypoxia-responsive element spanning HIF-1- and HNF-4-binding sites in 12 patients with erythrocytosis and 4 normal subjects. Four polymorphisms were found, none of which affected the HIF-1-binding site, although one polymorphism was present in the HNF-4 consensus region. The data indicate that none of these polymorphisms cause erythrocytosis.