937 resultados para Reação em cadeia da polimerase
Resumo:
O objetivo do presente trabalho foi verificar a resistência ao nematóide Meloidogyne mayaguensis em oito porta-enxertos de tomateiro considerados resistentes à Meloidogyne incognita, M. javanica e M. arenaria, comercializados no Brasil. Os porta-enxertos testados foram: 'Guardião', 'Helper-M', 'Anchor-T', 'Dr. K', 'Kagemuscha', 'TMA 809', 'Magnet' e 'He-Man'. O experimento constou de 9 tratamentos (8 porta-enxertos e a cultivar Rutgers utilizada como padrão de suscetibilidade), com 6 repetições, sendo cada parcela constituída por 1 planta por vaso, mantidas em casa de vegetação. As plantas foram inoculadas com 5.000 ovos e eventuais juvenis infectantes de M. mayaguensis. O experimento seguiu o delineamento inteiramente casualizado. Aos 60 dias da inoculação procederam-se as avaliações, quando foram avaliados os índices de galhas e massas de ovos, número de nematóides no solo e na raiz, peso do sistema radicular e o fator de reprodução. Todos os porta-enxertos estudados demonstraram-se suscetíveis a M. mayaguensis.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The nanostructures materials are characterized to have particle size smaller than 100 nm and could reach 1 nm. Due to the extremely reduced dimensions of the grains, the properties of these materials are significantly modified relatively when compared with the conventional materials. In the present work was accomplished a study and characterization of the molybdenum carbide, seeking obtain it with particles size in the nanometers order and evaluate its potential as catalyst in the reaction of partial methane oxidation. The method used for obtaining the molybdenum carbide was starting from the precursor ammonium heptamolybdate of that was developed in split into two oven, in reactor of fixed bed, with at a heating rate of 5ºC/min, in a flow of methane and hydrogen whose flow was of 15L/h with 5% of methane for all of the samples. The studied temperatures were 350, 500, 600, 650, 660, 675 and 700ºC and were conducted for 0, 60, 120 and 180 minutes, and the percent amount and the crystallite size of the intermediate phases were determined by the Rietveld refinement method. The carbide obtained at 660ºC for 3 hours of reaction showed the best results, 24 nm. Certain the best synthesis condition, a passivating study was accomplished, in these conditions, to verify the stability of the carbide when exposed to the air. The molybdenum carbide was characterized by SEM, TEM, elemental analysis, ICP-AES, TG in atmosphere of hydrogen and TPR. Through the elemental analysis and ICP-AES the presence carbon load was verified. TG in atmosphere of hydrogen proved that is necessary the passivating of the molybdenum carbide, because occur oxidation in room temperature. The catalytic test was accomplished in the plant of Fischer-Tropsch of CTGAS, that is composed of a reactor of fixed bed. Already the catalytic test showed that the carbide presents activity for partial oxidation, but the operational conditions should be adjusted to improve the conversion
Resumo:
Among the heterogeneous catalysts materials made from niobium show up as an alternative to meet the demand of catalysts for biodiesel production. This study aims to evaluate the potential of a heterogeneous catalyst derived from a complex of niobium in the reaction of methyl esterification of oleic acid. The catalyst was synthesized after calcination at different temperatures of a niobium complex ((NH4)3[NbO(C2O4)3].H2O) generating a niobium oxide nanostructure with a different commercial niobium oxide used to synthesize the complex. The commercial niobium oxide, the complex niobium and niobium catalyst were characterized by thermogravimetry (TG and DTA), surface area analysis (BET), scanning electron microscopy (SEM) and X-ray diffraction (XRD), showing the catalyst has researched morphological and crystallographic indicating a catalytic potential higher than that of commercial niobium oxide characteristics. Factorial with central composite design point, with three factors (calcination temperature, molar ratio of alcohol/oleic acid and mass percentage of catalyst) was performed. Noting that the optimal experimental point was given by the complex calcination temperature of 600°C, a molar ratio alcohol/oleic acid of 3.007/1 and the catalyst mass percentage of 7.998%, with a conversion of 22.44% oleic acid in methyl oleate to 60 min of reaction. We performed a composite linear and quadratic regression to determine an optimal statistical point of the reaction, the temperature of calcination of the complex at 450°C, the molar ratio of alcohol/oleic acid 3.3408/1 and mass percentage of catalyst of 7.6833% . Kinetic modeling to estimate parameters for heterogeneous catalysis it set well the experimental results with a final conversion of 85.01% with 42.38% of catalyst and without catalyst at 240 min reaction was performed. Allowing to evaluate the catalyst catalytic studied has the potential to be used in biodiesel production
Resumo:
OBJETIVO: Verificar a influência da utilização da fisioterapia complexa descongestiva associada à dietoterapia com triglicerídeos de cadeia média (TCM) como forma de intervenção no linfedema de membro superior (MS). MÉTODOS: Para a avaliação do linfedema, foram utilizadas cirtometria, volumetria, pregas cutâneas e quantidade de água corporal total. A Escala Visual Análoga (EVA) foi utilizada para avaliar as sensações de desconforto, peso e dor no MS. Participaram deste estudo dez mulheres mastectomizadas com linfedema de MS homolateral à cirurgia, com idade média de 65,9 ± 10,4 anos e índice de massa corpórea (IMC) de 26,8 ± 3,0kg/m² que, após avaliação nutricional, foram divididas aleatoriamente em dois grupos: Grupo Controle (n= 5), submetido ao tratamento fisioterapêutico constando da terapia complexa descongestiva (massagem clássica, drenagem linfática manual, bandagem compressiva e cuidados com a pele) três vezes na semana, durante quatro semanas; Grupo TCM (n= 5), submetido ao mesmo protocolo fisioterapêutico somado ao tratamento dietético diário com ingestão de TCM, por quatro semanas. RESULTADOS: Ao final da intervenção, a análise da cirtometria e da volumetria mostraram diferenças significativas entre os grupos (< 0,05), com maior redução do linfedema no Grupo TCM. Não houve diferença significativa nos valores das pregas cutâneas e da quantidade de água corporal total. A sensação de peso no membro superior, antes e após a intervenção, foi significativamente menor (< 0,05) no Grupo TCM. CONCLUSÕES: O tratamento fisioterapêutico somado à dietoterapia com ingestão de TCM em mulheres portadoras de linfedema de MS pós-cirurgia e tratamento de câncer de mama foi efetivo na involução desta condição.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
The aim of this work was the preparation of polyols from reactions between castor oil and dietanolamine to increase the hydroxyl content and the network degree in the products to application in electronic devices. The polyols and the mixtures obtained were characterized by nuclear magnetic ressonance. Castor oil (CO) is a natural triglyceride - based polyol possessing hydroxyl groups, which allow several reactions that produce many different products. Among them are the polyurethanes (PU), which have been considered an ideal product for the covering of electricelectronic circuits, due to their excellent electrical, shock-absorbing, solvents resistance and hydrolytic stability properties. About 90% of the fatty acids present in the castor oil are ricinoleic acid (12-hydroxyoleic acid), while the remaining 10% correspond to non-hydroxylated fatty acids, mainly linoleic and oleic acids. The chemical analysis of castor oil indicates a hydroxyl number of 2.7. In this work, a polyol was obtained by the reaction of the CO with diethanolamine (DEA), in order to elevate the hydroxyl value from 160 to 230 or to 280 mgKOH/g, and characterized by nuclear magnetic resonance (NMR) 1H and 13C (Mercury 200). The polyadition of the resulting polyol with isophorone diisocianate (IPDI) was carried out at 60°C, and the reaction kinetics was followed by rheological measurements in a Haake RS150 rheometer. The electrical properties were determined in a HP LCR Meter 4262A, at 1.0 Hz and 10.0 KHz. The chemical analysis showed that the polyols obtained presented hydroxyl number from 230 to 280 mgKOH/g. The polyadition reaction with IPDI produced polyurethane resins with the following properties: hardness in the range from 45 shore A to 65 shore D (ASTM D2240); a dielectric constant of 3.0, at 25°C (ASTM D150). Those results indicate that the obtained resins present compatible properties to the similar products of fossil origin, which are used nowadays for covering electric-electronic circuits. Therefore, the PUs from castor oil can be considered as alternative materials of renewable source, free from the highly harmful petroleum - derived solvents
Resumo:
Perovskites oxides win importance by its properties and commercials applications, they have a high thermal stability, have conductive properties, electrical, catalytic, electro catalytic, optical and magnetic, and are thermally stable. Because of these properties, are being widely studied as carriers of oxygen in the process of power generation with CO2 capture. In this work, the base carrier system La1-xMexNiO3 (Me = Ca and Sr) were synthesized by the method via the combustion reaction assisted by microwave. were synthesized from the combustion reaction method by microwave process. This method control the synthesi`s conditions to obtain materials with specific characteristics. The carriers calcined at 800 ° C/2h were analyzed by thermal analysis (TG-DTA), to verify its thermal stability, X-ray diffraction (XRD) to verify the phase formation, with subsequent refinement by the Rietveld method, to quantify the percentage of phases formed, the surface area by BET method was determined, scanning electron microscopy (SEM) was obtained to evaluate the material morphology and temperature programmed reduction (TPR) was done to observe the metallic phase of the nickel. After all proposed characterization and analysis of their results can be inferred to these oxides, key features so that they can be applied as carriers for combustion reactions in chemical cycles. The final products showed perovskite-type structures K2NiF4 (main) and ABO3.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
One of the main applications of methane is in the production of syngas, a mixture of hydrogen and carbon monoxide. Procedures used in this process are steam reforming, CO2 reforming, partial oxidation and autothermal reforming. The present study evaluated and compared the behavior of nickel catalysts supported on mixed oxides of cerium and manganese in the partial oxidation of methane with that of nickel catalysts supported on mixed oxides of cerium and zirconium. Mixed oxides of cerium and zirconium or cerium and manganese were synthesized using two different preparation methods, the polymeric precursor based on Pechini method and combustion reaction using a microwave. This was followed by impregnation with nickel content of 15 %. Samples were calcined at 300, 800 and 900 °C and characterized by specific surface area (SSA), X-ray fluorescence (XRF), X-ray diffraction (XRD), scanning electron microscopy (SEM), temperature programmed reduction (TPR) and the reaction of partial oxidation of methane. The specific areas of samples decrease with the rise in calcination temperature and after nickel impregnation. Metal-cerium solid solution was formed and the presence of other manganese species outside the solid solution structure was confirmed in the compound with the highest amounts of manganese oxides showed. With regard to scanning electron microscopy, supports based on cerium and zirconium prepared by Pechini method exhibited agglomerated particles without uniform geometry or visible pores on the surface. However, compounds containing manganese presented empty spaces in its structure. Through synthesis by combustion reaction, morphology acquired independently of the proposed composition demonstrated greater porosity in relation to Pechini synthesis. Although catalysts were prepared using different synthesis methods, the insertion of nickel showed very similar reduction profiles (TPR). In relation to nickel catalysts supported on mixed oxide of cerium and zirconium, there is an initial reduction of NiO species that present certain interaction with the support. This is followed by the reduction of Ce4+ in Ce3+ surface, with subsequent bulk reduction. For catalysts containing manganese, a reduction of nickel oxide species occurs, followed by two stages of reduction for species Mn2O3 in Mn3O4 and Mn3O4 in MnO, with subsequent reduction of bulk. With respect to partial oxidation reactions, the nickel catalyst supported on mixed oxide of cerium and zirconium, prepared using the Pechini method, exhibited CH4 conversion of approximately 80 %, with conversion of 81 % when prepared by combustion. This behavior continued for 10 hours of reaction. Manganese content was also found to directly influence catalytic activity of materials; the greater the manganese oxide content, the faster deactivation and destabilization occurred in the catalyst. In both synthesis methods, the nickel catalyst supported on mixed oxide of cerium and zirconium maintained an H2/CO ratio very close to 2 during the 10 hours of partial oxidation reaction. Samples containing manganese displayed smaller H2/CO ratios and lower performance in partial oxidation.
Resumo:
Chitosan is a biopolymer derived from the shells of crustaceans, biodegradable, inexpensive and renewable with important physical and chemical properties. Moreover, the different modifications possible in its chemical structure generate new properties, making it an attractive polysaccharide owing to its range of potential applications. Polymers have been used in oil production operations. However, growing concern over environmental constraints has prompted oil industry to search for environmentally sustainable materials. As such, this study sought to obtain chitosan derivatives grafted with hydrophilic (poly(ethylene glycol), mPEG) and/or hydrophobic groups (n-dodecyl) via a simple (one-pot) method and evaluate their physicochemical properties as a function of varying pH using rheology, small-angle Xray scattering (SAXS), dynamic light scattering (DLS) and zeta potential. The chitosan derivatives were prepared using reductive alkylation under mild reaction conditions and the chemical structure of the polymers was characterized by nuclear magnetic resonance (1H NMR) and CHN elemental analysis. Considering a constant mPEG/Chitosan molar ratio on modification of chitosan, the solubility of the polymer across a wide pH range (acidic, neutral and basic) could only be improved when some of the amino groups were submitted to reacetylation using the one-pot method. Under these conditions, solubility is maintained even with the simultaneous insertion of n-dodecyl. On the other hand, the solubility of derivatives obtained only through mPEG incorporation using the traditional methodology, or with the ndodecyl group, was similar to that of its precursor. The hydrophilic group promoted decreased viscosity of the polymer solutions at 10 g/L in acid medium. However, at basic pH, both viscosity and thermal stability increased, as well as exhibited a pronounced pseudoplastic behavior, suggesting strong intermolecular associations in the alkaline medium. The SAXS results showed a polyelectrolyte behavior with the decrease in pH for the polymer systems. DLS analyses revealed that although the dilute polymer solutions at 1 g/L and pH 3 exhibited a high density of protonated amino groups along the polymer chain, the high degree of charge contributed significantly to aggregation, promoting increased particle size with the decrease in pH. Furthermore, the hydrophobic group also contributed to increasing the size of aggregates in solution at pH 3, whereas the hydrophilic group helped reduce their size across the entire pH range. Nevertheless, the nature of aggregation was dependent on the pH of the medium. Zeta potential results indicated that its values do not depend solely on the surface charge of the particle, but are also dependent on the net charge of the medium. In this study, water soluble associative polymers exhibit properties that can be of great interest in the petroleum industry
Resumo:
Bifunctional catalysts based on zircon oxide modified by tungsten (W = 10, 15 and 20 %) and by molybdenum oxide (Mo= 10, 15 e 20 %) containg platinum (Pt = 1%) were prepared by the polymeric precursor method. For comparison, catalysts the tungsten base was also prepared by the impregnation method. After calcinations at 600, 700 and 800 ºC, the catalysts were characterized by X-ray diffraction, fourier-transform infrared spectroscopy, thermogravimetric and differential thermal analysis, nitrogen adsorption and scanning electron microscopy. The profile of metals reduction was determined by temperature programmed reduction. The synthesized catalysts were tested in n-heptane isomerization. X-ray diffractogram of the Pt/WOx-ZrO2 and Pt/MoOx-ZrO2 catalysts revealed the presence of tetragonal ZrO2 and platinum metallic phases in all calcined samples. Diffraction peaks due WO3 and ZrO2 monoclinic also were observed in some samples of the Pt/WOx-ZrO2 catalysts. In the Pt/MoOx-ZrO2 catalysts also were observed diffraction peaks due ZrO2 monoclinic and Zr(MoO4)2 oxide. These phases contained on Pt/WOx-ZrO2 and Pt/MoOx-ZrO2 catalysts varied in accordance with the W or Mo loading and in accordance with the calcination temperature. The infrared spectra showed absorption bands due O-W-O and W=O bonds in the Pt/WOx-ZrO2 catalysts and due O-Mo-O, Mo=O and Mo-O bonds in the Pt/MoOx-ZrO2 catalysts. Specific surface area for Pt/WOx-ZrO2 catalysts varied from 30-160 m2 g-1 and for the Pt/MoOx-ZrO2 catalysts varied from 10-120 m2 g-1. The metals loading (W or Mo) and the calcination temperature influence directly in the specific surface area of the samples. The reduction profile of Pt/WOx-ZrO2 catalysts showed two peaks at lower temperatures, which are attributed to platinum reduction. The reduction of WOx species was evidenced by two reduction peak at high temperatures. In the case of Pt/MoOx-ZrO2 catalysts, the reduction profile showed three reduction events, which are attributed to reduction of MoOx species deposited on the support and in some samples one of the peak is related to the reduction of Zr(MoO4)2 oxide. Pt/WOx-ZrO2 catalysts were active in the n-heptane isomerization with high selectivity to 3-methyl-hexane, 2,3- dimethyl-pentane, 2-methyl-hexane among other branched hydrocarbons. The Pt/MoOx-ZrO2 catalysts practically didn't present activity for the n-heptane isomerization, generating mainly products originating from the catalytic cracking
Resumo:
The paper demonstrates how it is organized production chain of natural gas in Rio Grande do Norte and highlights some prospects for this sector. The study is backed by elements to understand the process of innovation as the driving force of capitalist dynamics as well as the features of the Brazilian economy in the years 1990 and 2000 that indicated the development of natural gas production in the energy matrix Brazil. It was found that the state has potiguar possibilities for structuring an energy based on elements from the region and with prospects of becoming self-sufficient in electricity, where natural gas has a share of participation in this segment. The automotive and industrial are the biggest consumers of this input. With emphasis on the textile industry. Signaling to a broad horizon of supply, this sector will depend on their investments in research and Deficient, and the policy adopted by government to develop the consumer market
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
This thesis focuses on the coprecipitation synthesis method for preparation of ceramic materials with perovskite structure, their characterization and application as catalytic material in the reaction of converting CO to CO2 developing a methodological alternative route of synthesis from the middle via oxalate coprecipitation material SrCo0,8Fe0,2O3-d. In order to check the influence of this method, it was also synthesized using a combined citrate - EDTA complexing method. The material was characterized by: X-ray diffraction (XRD), Rietveld refinement method, thermogravimetry and differential thermo analysis (TG / DTA), scanning (SEM) and transmission (TEM) electron microscopy, particle size distribution and surface analysis method BET. Both methods led to post-phase synthesis, with pH as a relevant parameter. The synthesis based on the method via oxalate coprecipitation among particles led to the crystalline phase as those obtained using a combined citrate - EDTA complexing method under the same conditions of heat treatment. The nature of the reagent used via oxalate coprecipitation method produced a material with approximately 80 % lower than the average size of crystallites. Moreover, the via oxalate coprecipitation method precursors obtained in the solid state at low temperature (~ 26 oC), shorter synthesis, greater thermal stability and a higher yield of around 90-95 %, maintaining the same order of magnitude the crystallite size that the combined citrate - EDTA complexing method. For purposes of comparing the catalytic properties of the material was also synthesized by the using a combined citrate - EDTA complexing method. The evaluation of catalytic materials SrCo0,8Fe0,2O3-d LaNi0,3Co0,7O3-d was accompanied on the oxidation of CO to CO2 using a stainless steel tubular reactor in the temperature range of 75-300 oC. The conversion CO gas was evaluated in both materials on the results shaved that the firm conversion was loves for the material LaNi0,3Co0,7O3-d