Living planktonic foraminifera from the northwestern Pacific Ocean: SSU rDNA sequences and their paleoceanographic significance

Living planktonic foraminifera (PF) samples from the Okinawa Trough of the northwestern Pacific Ocean were taken for DNA analysis. The SSU rDNA sequences of two PF species, Globigerina sp. and Pulleniatina obliquiloculata collected at Station WP01, were obtained and compared with those from the southwestern Pacific Ocean. Only small differences (< 0.7%-1.2% for P. obliquiloculata, and 0.3% for Globigerina sp.) were found between samples from the north- and south-western Pacific Ocean areas and this molecular evidence supported that these micropaleontological species are the same species, which implies that the West Pacific Ocean circulation system influences the planktonic foraminiferal gene communication.

Mining expressed sequences for single nucleotide polymorphisms in Pacific abalone Haliotis discus hannai

Although single nucleotide polymorphisms (SNPs) are important resources for population genetics, pedigree analysis and genomic mapping, such loci have not been reported in Pacific abalone so far. In this study, a bioinformatics strategy was adopted to discover SNPs within the expressed sequences (ESTs) of Pacific abalone, Haliotis discus hannai, and furthermore, polymerase chain reaction direct sequencing (PCR-DS) and allele-specific PCR (AS-PCR) were used for SNPs detection and genotype scoring respectively. A total of 5893 ESTs were assembled and 302 putative SNPs were identified. The average density of SNPs in ESTs was 1%. Fifty-two sets of sequencing primers were designed from SNPs flanking ESTs to amplify the genomic DNA, and 13 could generate products of expected size. Polymerase chain reaction direct sequencing of the amplification products from pooled DNA samples revealed 40 polymorphic SNP loci. Using a modified tetra-primer AS-PCR, seven mitochondrial and six nuclear SNPs were typed and characterized among 37 wild abalones. In conclusion, it is feasible to discover SNPs from number limited ESTs and the AS-PCR as a simple, robust and reliable assay could be a primary method for small- and medium-scale SNPs detection in abalones as well as other non-model organisms.

Characterization of eastern oyster (Crassostrea virginica Gmelin) chromosomes by fluorescence in situ hybridization with bacteriophage P1 clones

Chromosome identification is an essential step in genomic research, which so far has not been possible in oysters. We tested bacteriophage P1 clones for chromosomal identification in the eastern oyster Crassostrea virginica, using fluorescence in situ hybridization (FISH). P1 clones were labeled with digoxigenin-11-dUTP using nick translation. Hybridization was detected with fluorescein-isothiocyanate-labeled anti-digoxigenin antibodies and amplified with 2 layers of antibodies. Nine of the 21 P1 clones tested produced clear and consistent FISH signals when Cot-1 DNA was used as a blocking agent against repetitive sequences. Karyotypic analysis and cohybridization positively assigned the 9 P1 clones to 7 chromosomes. The remaining 3 chromosomes can be separated by size and arm ratio. Five of the 9 P1 clones were sequenced at both ends, providing sequence-tagged sites that can be used to integrate linkage and cytogenetic maps. One sequence is part of the bone morphogenetic protein type 1b receptor, a member of the transforming growth factor superfamily, and mapped to the telomeric region of the long arm of chromosome 2. This study shows that large-insert clones such as P1 are useful as chromosome-specific FISH probes and for gene mapping in oysters.

Phylogenetic origins of the Himalayan endemic Dolomiaea, Diplazoptilon and Xanthopappus (Asteraceae : Cardueae) based on three DNA regions

Background and Aims It is an enduring question as to the mechanisms leading to the high diversity and the processes producing endemics with unusual morphologies in the Himalayan alpine region. In the present study, the phylogenetic relationships and origins of three such endemic genera were analysed, Dolomiaea, Diplazoptilon and Xanthopappus, all in the tribe Cardueae of Asteraceae.Methods The nuclear rDNA internal transcribed spacer (ITS) and plastid trnL-F and psbA-trnH regions of these three genera were sequenced. The same regions for other related genera in Cardueae were also sequenced or downloaded from GenBank. Phylogenetic trees were constructed from individual and combined data sets of the three types of sequences using maximum parsimony, maximum likelihood and Bayesian analyses.Key Results The phylogenetic tree obtained allowed earlier hypotheses concerning the relationships of these three endemic genera based on gross morphology to be rejected. Frolovia and Saussurea costus were deeply nested within Dolomiaea, and the strong statistical support for the Dolomiaea-Frolovia clade suggested that circumscription of Dolomiaea should be more broadly redefined. Diplazoptilon was resolved as sister to Himalaiella, and these two together are sister to Lipschitziella. The clade comprising these three genera is sister to Jurinea, and together these four genera are sister to the Dolomiaea-Frolovia clade. Xanthopappus, previously hypothesized to be closely related to Carduus, was found to be nested within a well-supported but not fully resolved Onopordum group with Alfredia, Ancathia, Lamyropappus, Olgaea, Synurus and Syreitschikovia, rather than the Cardinis group. The crude dating based on ITS sequence divergence revealed that the divergence time of Dolomiaea-Frolovia from its sister group probably occurred 13.6-12.2 million years ago (Ma), and the divergence times of the other two genera, Xanthopappus and Diplazoptilon, from their close relatives around 5.7-4.7 Ma and 2.0-1.6 Ma, respectively.Conclusions The findings provide an improved understanding of the intergeneric relationships in Cardueae. The crude calibration of lineages indicates that the uplifts of the Qiinghai -Tibetan Plateau since the Miocene might have served as a continuous stimulus for the production of these morphologically aberrant endemic elements of the Himalayan flora.

Molecular phylogeny of some genera of Pamphagidae (Acridoidea, Orthoptera) from China based on mitochondrial 16S rDNA sequences

Based on the mitochondrial 16S ribosomal DNA partial sequences (473 bp) of 9 species of Pamphagidae (Acridoidea, Orthoptera) from China and of 4 species of Pamphagidae and 2 species of Pyrgomorphidae and Acrididae (as outgroups) retrieved from GenBank, we constructed the molecular phylogeny using the Neighbor Joining (NJ) and Minimum Evolution ( ME) methods based on the nucleotide Kimura 2-parameter model. The results of our study shown that: 1) the ranges of the 16S rDNA nucleotide divergence between two species of a genus were 0.21%, among genera of a subfamily were 0.42-3.38%, and among subfamilies of Pamphagidae were 1.90-8.88%, respectively. The phylogenetic tree shows that: 1) all Pamphagidae taxa form a monophyletic clade, and are well separated from the outgroup; 2) the African taxa Porthetinae (Lobosceliana brevicornis) and Akicerinae (Batrachotetrix sp.) are distinctly separated from the Chinese taxa Prionotropisinae; 3) Haplotropis bruneriana and Glauia terrea of Pamphaginae are nested in the middle of the tree, but their phylogenetic status is uncertain in this study; 4) 8 genera of Asiotmethis, Beybienkia, Mongolotmethis, Sinotmethis, Rhinotmethis, Filchnerella, Eotmethis and Pseudotmethis from China are all grouped into the subfamily Prionotropisinae, but their phylogenetic relationships are not clearly resolved.

A molecular marker that is specific to medicinal rhubarb based on chloroplast trnL/trnF sequences

"Da-Huang" (Radix et Rhizoma Rhei, medicinal rhubarb), a famous and important Traditional Chinese Medicine, has often been confused with the adulterant species in the same genus, Rheum. Through sequencing the trnL (UAA)/trnF (GAA) regions of chloroplast DNA of thirteen species of Rheum (three medicinal rhubarb species and ten adulterant ones), a molecular marker of the medicinal species was found. A pair of PCR primers based on the sequences, was thus designed, which amplified a highly specific DNA fragment in medicinal rhubarb exclusively, and absent in the adulterants at all under an optimized PCR condition.

A homogeneous DNA hybridization system by using a new luminescence terbium chelate

Homogeneous DNA hybridization assay based on the luminescence resonance energy transfer (LRET) from a new luminescence terbium chelate, N,N,N-1,N-1-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)-4-phenylpyridine]tetrakis(acetic acid) (BPTA)-Tb3+ (lambda(ex) = 325 nm and lambda(em) = 545 nm) to an organic dye, Cy3 (A,. = 548 nm and A,. = 565 nm), has been developed. In the system, two DNA probes whose sequences are complementary to the two different consecutive sequences of a target DNA are used; one of the probes is labeled with the Tb3+ chelate at the T-end, and the other is with Cy3 at the 5'-end. Labeling of the Tb3+ chelate is accomplished via the linkage of a biotin-labeled DNA probe with the Tb3+ chelate-labeled streptavidin. Strong sensitized emission of Cy3 was observed upon excitation of the Tb3+ chelate at 325 run, when the two probe DNAs were hybridized with the target DNA. The sensitivity of the assay was very high compared with those of the previous homogeneous-format assays using the conventional organic dyes; the detection limit of the present assay is about 30 pM of the target DNA strand.

Analysis of Sequence Periodicity in E. coli Proteins: Empirical Investigation of the ?Duplication and Divergence? Theory of Protein Evolution

Gatherer, D., and McEwan, N.R. (2003). Analysis of sequence periodicity in E. coli proteins: empirical investigation of the 'duplication and divergence' theory of protein evolution. Journal of Molecular Evolution 57, 149-158. RAE2008

Secondary structure effects on DNA hybridization kinetics: a solution versus surface comparison

The hybridization kinetics for a series of designed 25mer probe�target pairs having varying degrees of secondary structure have been measured by UV absorbance and surface plasmon resonance (SPR) spectroscopy in solution and on the surface, respectively. Kinetic rate constants derived from the resultant data decrease with increasing probe and target secondary structure similarly in both solution and surface environments. Specifically, addition of three intramolecular base pairs in the probe and target structure slow hybridization by a factor of two. For individual strands containing four or more intramolecular base pairs, hybridization cannot be described by a traditional two-state model in solution-phase nor on the surface. Surface hybridization rates are also 20- to 40-fold slower than solution-phase rates for identical sequences and conditions. These quantitative findings may have implications for the design of better biosensors, particularly those using probes with deliberate secondary structure.

Recursive directional ligation by plasmid reconstruction allows rapid and seamless cloning of oligomeric genes.

This paper reports a new strategy, recursive directional ligation by plasmid reconstruction (PRe-RDL), to rapidly clone highly repetitive polypeptides of any sequence and specified length over a large range of molecular weights. In a single cycle of PRe-RDL, two halves of a parent plasmid, each containing a copy of an oligomer, are ligated together, thereby dimerizing the oligomer and reconstituting a functional plasmid. This process is carried out recursively to assemble an oligomeric gene with the desired number of repeats. PRe-RDL has several unique features that stem from the use of type IIs restriction endonucleases: first, PRe-RDL is a seamless cloning method that leaves no extraneous nucleotides at the ligation junction. Because it uses type IIs endonucleases to ligate the two halves of the plasmid, PRe-RDL also addresses the major limitation of RDL in that it abolishes any restriction on the gene sequence that can be oligomerized. The reconstitution of a functional plasmid only upon successful ligation in PRe-RDL also addresses two other limitations of RDL: the significant background from self-ligation of the vector observed in RDL, and the decreased efficiency of ligation due to nonproductive circularization of the insert. PRe-RDL can also be used to assemble genes that encode different sequences in a predetermined order to encode block copolymers or append leader and trailer peptide sequences to the oligomerized gene.

Nucleolar organization, ribosomal DNA array stability, and acrocentric chromosome integrity are linked to telomere function.

The short arms of the ten acrocentric human chromosomes share several repetitive DNAs, including ribosomal RNA genes (rDNA). The rDNA arrays correspond to nucleolar organizing regions that coalesce each cell cycle to form the nucleolus. Telomere disruption by expressing a mutant version of telomere binding protein TRF2 (dnTRF2) causes non-random acrocentric fusions, as well as large-scale nucleolar defects. The mechanisms responsible for acrocentric chromosome sensitivity to dysfunctional telomeres are unclear. In this study, we show that TRF2 normally associates with the nucleolus and rDNA. However, when telomeres are crippled by dnTRF2 or RNAi knockdown of TRF2, gross nucleolar and chromosomal changes occur. We used the controllable dnTRF2 system to precisely dissect the timing and progression of nucleolar and chromosomal instability induced by telomere dysfunction, demonstrating that nucleolar changes precede the DNA damage and morphological changes that occur at acrocentric short arms. The rDNA repeat arrays on the short arms decondense, and are coated by RNA polymerase I transcription binding factor UBF, physically linking acrocentrics to one another as they become fusogenic. These results highlight the importance of telomere function in nucleolar stability and structural integrity of acrocentric chromosomes, particularly the rDNA arrays. Telomeric stress is widely accepted to cause DNA damage at chromosome ends, but our findings suggest that it also disrupts chromosome structure beyond the telomere region, specifically within the rDNA arrays located on acrocentric chromosomes. These results have relevance for Robertsonian translocation formation in humans and mechanisms by which acrocentric-acrocentric fusions are promoted by DNA damage and repair.

An Exploration into Fern Genome Space.

Ferns are one of the few remaining major clades of land plants for which a complete genome sequence is lacking. Knowledge of genome space in ferns will enable broad-scale comparative analyses of land plant genes and genomes, provide insights into genome evolution across green plants, and shed light on genetic and genomic features that characterize ferns, such as their high chromosome numbers and large genome sizes. As part of an initial exploration into fern genome space, we used a whole genome shotgun sequencing approach to obtain low-density coverage (∼0.4X to 2X) for six fern species from the Polypodiales (Ceratopteris, Pteridium, Polypodium, Cystopteris), Cyatheales (Plagiogyria), and Gleicheniales (Dipteris). We explore these data to characterize the proportion of the nuclear genome represented by repetitive sequences (including DNA transposons, retrotransposons, ribosomal DNA, and simple repeats) and protein-coding genes, and to extract chloroplast and mitochondrial genome sequences. Such initial sweeps of fern genomes can provide information useful for selecting a promising candidate fern species for whole genome sequencing. We also describe variation of genomic traits across our sample and highlight some differences and similarities in repeat structure between ferns and seed plants.

IGF-1 or insulin, and the TSH cyclic AMP cascade separately control dog and human thyroid cell growth and DNA synthesis, and complement each other in inducing mitogenesis.

The regular doubling of cell mass, and therefore of cell protein content, is required for repetitive cell divisions. Preliminary observations have shown that in dog thyrocytes insulin induces protein accumulation but not DNA synthesis, while TSH does not increase protein accumulation but triggers DNA synthesis in the presence of insulin. We show here that EGF and phorbol myristate ester complement insulin action in the same way. HGF is the only factor activating both protein accumulation and DNA synthesis. The effects of insulin on protein accumulation and in permitting the TSH effect are reproduced by IGF-1 and are mediated, at least in part by the IGF-1 receptor. The concentration effect curves are similar for both effects. Similar results are obtained in human thyrocytes. They reflect true cell growth, as shown by increases in RNA content and cell size. Carbachol and fetal calf serum also stimulate protein synthesis and accumulation without triggering DNA synthesis, but they are not permissive for the mitogenic effects of TSH or of the general adenylate cyclase activator, forskolin. Moreover the mitogenic effect of TSH greatly decreased in cells deprived of insulin for 2 days although these cells remain hypertrophic. Hypertrophy may therefore be necessary for cell division, but it is not sufficient to permit it. Three different mechanisms can therefore be distinguished in the mitogenic action of TSH: (1) the increase of cell mass (hypertrophy) induced by insulin or IGF-1; (2) the permissive effect of insulin or IGF-1 on the mitogenic effect of TSH which may involve both the increase of cell mass and the induction of specific proteins such as cyclin D3 and (3) the mitogenic effect of the TSH cyclic AMP cascade proper.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DNA from pollen: principles and potential

This paper describes our recent extraction of ancient DNA (aDNA) from Holocene pollen and discusses the potential of the technique for elucidating timescales of evolutionary change. We show that plastid DNA is recoverable and usable from pollen grains of Scots pine Pinus sylvestris from 10 ka and 100 years ago. Comparison of the ancient sequences with modern sequences, obtained from an extant population, establish a first genetic link between modern and fossil samples of Scots pine, providing a genetic continuity through time. One common haplotype is present in each of the three periods investigated, suggesting that it persisted near the lake throughout the postglacial. The retrieval of aDNA from pollen has major implications for palaeoecology by allowing (i) investigation of population level dynamics in time and space, and (ii) tracing ancestry of populations and developing phylogenetic trees that include extinct as well as extant taxa. The method should work over the last glacial oscillation, thus giving access to ancestry of populations over a crucial period of time for the understanding of the relationship between speciation and climate change.