921 resultados para human cell
Resumo:
Five structurally related thiophene and furane analogues of the oxathiin carboxanilide derivative NSC 615985 (UC84) (designated UC10, UC68, UC81, UC42, and UC16) were identified as potent inhibitors of HIV-1 replication in cell culture and HIV-1 reverse transcriptase activity. These compounds were markedly active against a series of mutant HIV-1 strains, containing the Leu-100-->Ile, Val-106-->Ala, Glu-138-->Lys, or Tyr-181-->Cys mutations in their reverse transcriptase. However, the thiocarboxanilide derivatives selected for mutations at amino acid positions 100 (Leu-->Ile), 101 (Lys-->Ile/Glu), 103 (Lys-->Thr/Asp) and 141 (Gly-->Glu) in the HIV-1 reverse transcriptase. The compounds completely suppressed HIV-1 replication and prevented the emergence of resistant virus strains when used at 1.3-6.6 microM--that is, 10- to 25-fold lower than the concentration required for nevirapine and bis(heteroaryl)piperazine (BHAP) U90152 to do so. If UC42 was combined with the [2',5'-bis-O-(tert-butyldimethylsilyl)-3'-spiro-5"-(4"-amino-1",2"- oxathiole-2",2"-dioxide)]-beta-D-pentofuranosyl (TSAO) derivative of N3-methylthymine (TSAO-m3T), virus breakthrough could be prevented for a much longer time, and at much lower concentrations, than if the compounds were used individually. Virus breakthrough could be suppressed for even longer, and at lower drug concentrations, if BHAP was added to the combination of UC42 with TSAO-m3T, which points to the feasibility of two- or three-drug combinations in preventing virus breakthrough and resistance development.
Resumo:
Poly(ADP-ribose) polymerase [PARP; NAD+ ADP-ribosyltransferase; NAD+:poly(adenosine-diphosphate-D-ribosyl)-acceptor ADP-D-ribosyltransferase, EC 2.4.2.30] is a zinc-dependent eukaryotic DNA-binding protein that specifically recognizes DNA strand breaks produced by various genotoxic agents. To study the biological function of this enzyme, we have established stable HeLa cell lines that constitutively produce the 46-kDa DNA-binding domain of human PARP (PARP-DBD), leading to the trans-dominant inhibition of resident PARP activity. As a control, a cell line was constructed, producing a point-mutated version of the DBD, which has no affinity for DNA in vitro. Expression of the PARP-DBD had only a slight effect on undamaged cells but had drastic consequences for cells treated with genotoxic agents. Exposure of cell lines expressing the wild-type (wt) or the mutated PARP-DBD, with low doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) resulted in an increase in their doubling time, a G2 + M accumulation, and a marked reduction in cell survival. However, UVC irradiation had no preferential effect on the cell growth or viability of cell lines expressing the PARP-DBD. These PARP-DBD-expressing cells treated with MNNG presented the characteristic nucleosomal DNA ladder, one of the hallmarks of cell death by apoptosis. Moreover, these cells exhibited chromosomal instability as demonstrated by higher frequencies of both spontaneous and MNNG-induced sister chromatid exchanges. Surprisingly, the line producing the mutated DBD had the same behavior as those producing the wt DBD, indicating that the mechanism of action of the dominant-negative mutant involves more than its DNA-binding function. Altogether, these results strongly suggest that PARP is an element of the G2 checkpoint in mammalian cells.
Resumo:
Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.
Resumo:
Multiple mammary epithelial cell (MEC) types are observed both in mammary ducts in vivo and in primary cultures in vitro; however, the oncogenic potential of different cell types remains unknown. Here, we used human papilloma virus 16 E6 and E7 oncogenes, which target p53 and Rb tumor suppressor proteins, respectively, to immortalize MECs present in early or late passages of human mammary tissue-derived cultures or in milk. One MEC subtype was exclusively immortalized by E6; such cells predominated in late-passage cultures but were rare at early passages and apparently absent in milk. Surprisingly, a second cell type, present only in early-passage tissue-derived cultures, was fully immortalized by E7 alone. A third cell type, observed in tissue-derived cultures and in milk, showed a substantial extension of life span with E7 but eventually senesced. Finally, both E6 and E7 were required to fully immortalize milk-derived MECs and a large proportion of MECs in early-passage tissue-derived cultures, suggesting the presence of another discrete subpopulation. Identification of MECs with distinct susceptibilities to p53- and Rb-targeting human papillomavirus oncogenes raises the possibility that these cells may serve as precursors for different forms of breast cancer.
Resumo:
Peripheral blood leukocytes incubated with a semisynthetic phage antibody library and fluorochrome-labeled CD3 and CD20 antibodies were used to isolate human single-chain Fv antibodies specific for subsets of blood leukocytes by flow cytometry. Isolated phage antibodies showed exclusive binding to the subpopulation used for selection or displayed additional binding to a restricted population of other cells in the mixture. At least two phage antibodies appeared to display hitherto-unknown staining patterns of B-lineage cells. This approach provides a subtractive procedure to rapidly obtain human antibodies against known and novel surface antigens in their native configuration, expressed on phenotypically defined subpopulations of cells. This approach does not depend on immunization procedures or the necessity to repeatedly construct phage antibody libraries.
Resumo:
Human T-cell leukemia virus type I (HTLV-I) gives rise to a neurologic disease known as HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Although the pathogenesis of the disease is unknown, the presence of a remarkably high frequency of Tax-specific, cytotoxic CD8 T cells may suggest a role of these cells in the development of HAM/TSP. Antigen-mediated signaling in a CD8 T-cell clone specific for the Tax(11-19) peptide of HTLV-I was studied using analog peptides substituted in their T-cell receptor contact residues defined by x-ray crystallographic data of the Tax(11-19) peptide in the groove of HLA-A2. CD8 T-cell stimulation with the wild-type peptide antigen led to activation of p56lck kinase activity, interleukin 2 secretion, cytotoxicity, and clonal expansion. A Tax analog peptide with an alanine substitution of the T-cell receptor contact residue tyrosine-15 induced T-cell-mediated cytolysis without activation of interleukin 2 secretion or proliferation. Induction of p56lck kinase activity correlated with T-cell-mediated cytotoxicity, whereas interleukin 2 secretion correlated with [3H]thymidine incorporation and proliferation. Moreover, Tax peptide analogs that activated the tyrosine kinase activity of p56lck could induce unresponsiveness to secondary stimulation with the wild-type peptide. These observations show that a single amino acid substitution in a T-cell receptor contact residue of Tax can differentially signal CD8 T cells and further demonstrate that primary activation has functional consequences for the secondary response of at least some Tax-specific CD8 T cells to HTLV-I-infected target cells.
Resumo:
We report characterization of a human T-cell lymphotropic virus type II (HTLV-II) isolated from an interleukin 2-dependent CD8 T-cell line derived from peripheral blood mononuclear cells of a healthy, HTLV-II-seropositive female Bakola Pygmy, aged 59, living in a remote equatorial forest area in south Cameroon. This HTLLV-II isolate, designated PYGCAM-1, reacted in an indirect immunofluorescence assay with HTLV-II and HTLV-I polyclonal antibodies and with an HTLV-I/II gp46 monoclonal antibody but not with HTLV-I gag p19 or p24 monoclonal antibodies. The cell line produced HTLV-I/II p24 core antigen and retroviral particles. The entire env gene (1462 bp) and most of the long terminal repeat (715 bp) of the PYGCAM-1 provirus were amplified by the polymerase chain reaction using HTLV-II-specific primers. Comparison with the long terminal repeat and envelope sequences of prototype HTLV-II strains indicated that PYGCAM-1 belongs to the subtype B group, as it has only 0.5-2% nucleotide divergence from HTLV-II B strains. The finding of antibodies to HTLV-II in sera taken from the father of the woman in 1984 and from three unrelated members of the same population strongly suggests that PYGCAM-1 is a genuine HTLV-II that has been present in this isolated population for a long time. The low genetic divergence of this African isolate from American isolates raises questions about the genetic variability over time and the origin and dissemination of HTLV-II, hitherto considered to be predominantly a New World virus.
Resumo:
The squamous cell carcinoma antigen (SCCA) is a member of the ovalbumin family of serine proteinase inhibitors (serpins). A neutral form of the protein is found in normal and some malignant squamous cells, whereas an acidic form is detected exclusively in tumor cells and in the circulation of patients with squamous cell tumors. In this report, we describe the cloning of the SCCA gene from normal genomic DNA. Surprisingly, two genes were found. They were tandemly arrayed and flanked by two other closely related serpins, plasminogen activator inhibitor type 2 (PAI2) and maspin at 18q21.3. The genomic structure of the two genes, SCCA1 and SCCA2, was highly conserved. The predicted amino acid sequences were 92% identical and suggested that the neutral form of the protein was encoded by SCCA1 and the acidic form was encoded by SCCA2. Further characterization of the region should determine whether the differential expression of the SCCA genes plays a causal role in development of more aggressive squamous cell carcinomas.
Resumo:
In the present study, we define a group of natural killer (NK) clones (group 0) that fails to lyse all of the normal allogeneic target cells analyzed. Their specificity for HLA class I molecules was suggested by their ability to lyse class I-negative target cells and by the fact that they could lyse resistant target cells in the presence of selected anti-class I monoclonal antibodies. The use of appropriate target cells represented by either HLA-homozygous cell lines or cell transfectants revealed that these clones recognized all the HLA-C alleles. By the use of monoclonal antibodies directed to either GL183 or EB6 molecules, we showed that the EB6 molecules were responsible for the recognition of Cw4 and related alleles, while the GL183 molecules recognized Cw3 (and related C alleles). These data suggest that the GL183 and the EB6 molecules can function, in individual NK clones, as independent receptors for two different groups of HLA-C alleles, (which include all known alleles for locus C), thus resulting in their inability to lyse all normal HLA-C+ target cells. Indirect immunofluorescence and fluorescence-activated cell sorting analysis revealed that the presently defined GL183+EB6+ group 0 NK clones brightly express EB6 molecules (EB6bright) while the GL183+EB6+ group 2 clones (unable to recognize Cw4) express an EB6dull phenotype. These data also imply that the density of EB6 receptors may be critical for the generation of an optimal negative signal upon interaction with appropriate HLA-C alleles.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Human adipose mesenchymal stem cells are a heterogeneous population, where cell cultures derived from single cell-expanded clones present varying degrees of differential plasticity. This work focuses on the immunomodulatory/anti-inflammatory properties of these cells. To this end, 5 single cell clones were isolated (generally called 1.X and 3.X) from 2 volunteers. Regarding the expression level of the lineage-characteristic surface antigens, clones 1.10 and 1.22 expressed the lowest amounts, while clones 3.10 and 3.5 expressed more CD105 than the rest and clone 1.7 expressed higher amounts of CD73 and CD44. Regarding cytokine secretion, all clones were capable of spontaneously releasing high levels of IL-6 and low to moderate levels of IL-8. These differences can be explained in part by the distinct methylation profile exhibited by the clones. Furthermore and after lipopolysaccharide stimulation, clone 3.X produced the highest amounts of pro-inflammatory cytokines such as IL-1β, while clones 1.10 and 1.22 highly expressed IL-4 and IL-5. In co-culture experiments, clones 1.X are altogether more potent inhibitors than clones 3.X for proliferation of total, CD3+T, CD4+T and CD8+T lymphocytes and NK cells. The results of this work indicates that adipose stem cell population is heterogeneous in cytokine production profile, and that isolation, characterization and selection of the appropriate cell clone is a more exact method for the possible treatment of different patients or pathologies.
Resumo:
Mode of access: Internet.
Resumo:
The progression of renal disease correlates strongly with hypertension and the degree of proteinuria, suggesting a link between excessive Na+ reabsorption and exposure of the proximal tubule to protein. The present study investigated the effects of albumin on cell growth and Na+ uptake in primary cultures of human proximal tubule cells (PTC). Albumin (1.0 mg/ml) increased cell proliferation to 134.1 +/- 11.8% (P < 0.001) of control levels with no change in levels of apoptosis. Exposure to 0.1 and 1.0 mg/ml albumin increased total Na-22(+) uptake to 119.1 &PLUSMN; 6.3% (P = 0.005) and 115.6 &PLUSMN; 5.3% (P < 0.006) of control levels, respectively, because of an increase in Na+/H+ exchanger isoform 3 (NHE3) activity. This was associated with an increase in NHE3 mRNA to 161.1 +/- 15.1% (P < 0.005) of control levels in response to 0.1 mg/ml albumin. Using confocal microscopy with a novel antibody raised against the predicted extracellular NH2 terminus of human NHE3, we observed in nonpermeabilized cells that exposure of PTC to albumin (0.1 and 1.0 mg/ml) increased NHE3 at the cell surface to 115.4 &PLUSMN; 2.7% (P < 0.0005) and 122.4 +/- 3.7% (P < 0.0001) of control levels, respectively. This effect was paralleled by significant increases in NHE3 in the subplasmalemmal region as measured in permeabilized cells. These albumin-induced increases in expression and activity of NHE3 in PTC suggest a possible mechanism for Na+ retention in response to proteinuria.
Resumo:
Individuals with periodontitis have been reported to have a significantly increased risk of developing coronary heart disease. Several studies have demonstrated that the immune response to heat shock protein 60 (HSP60) may be involved in the pathogenesis of both atherosclerosis and chronic periodontitis. To investigate this possible link between these diseases, cellular and humoral immune responses to HSP60 in atherosclerosis patients were compared with those in periodontitis patients and healthy subjects using human and Porphyromonas gingivalis HSP60 (GroEL) as antigens. Antibody levels to both human and P. gingivalis HSP60s were the highest in atherosclerosis patients, followed by periodontitis patients and healthy subjects. Clonal analysis of the T cells clearly demonstrated the presence of not only human HSP60- but also P. gingivalis GroEL-reactive T-cell populations in the peripheral circulation of atherosclerosis patients. Furthermore, these HSP60-reactive T cells seemed to be present in atherosclerotic lesions in some patients. These results suggest that T-cell clones with the same specificity may be involved in the pathogenesis of the different diseases.
Resumo:
The persistence of the E7 oncoprotein in transformed cells in human papillomavirus (HPV)-associated cervical cancer provides a tumour-specific antigen to which immunotherapeutic strategies may be directed. Self-replicating RNA (replicon) vaccine vectors derived from the flavivirus Kunjin (KUN) have recently been reported to induce T-cell immunity. Here, we report that inclusion of a CTL epitope of HPV16 E7 protein into a polyepitope encoded by a KUN vector induced E7-directed T-cell responses and protected mice against challenge with an E7-expressing epithelial tumour. We found replicon RNA packaged into virus-like particles to be more effective than naked replicon RNA or plasmid DNA constructed to allow replicon RNA transcription in vivo. Protective immunity was induced although the E7 CTL epitope was subdominant in the context of other CTL epitopes in the polyepitope. The results demonstrate the efficacy of the KUN replicon vector system for inducing protective immunity directed towards a virally encoded human tumour-specific antigen, and for inducing multi-epitopic CTL responses. (C) 2004 Elsevier Inc. All rights reserved.