Studies on immobilization of Bacteria

Cell immnhilizatinn technology in a rapidly expanding arna in the endeavour of microbial fnrmentatiwn.During the lnmt 15 years anveral prnceafinn have been developed and more are in developmental atage of approaching commercial utilizatinn.In the present programme it was planned to develop an optimized process for the innobilization of alpha amylase producing Bacillus polymyxa (CBTB 25) an isolate obtained from Cochin University campus primarily for the production of alpha-amylase.Optimal concentration of support material that attributaa stability and maximal activity to the immobilized cell beads was determined using different concentrations of sodium aliginate as support and estimation of amylase production.An overeall assessment of the data obtained for the various studies conducted denotes that immobilized cells synthesize alpha-amylase at comparable rates with free cells and produce reducing sugara at a higher level than free cells.Results indicated that both phosphate and citrate buffers could be used for disrupting the immobilized beads since they enforced maximal release of cells through leaching from the beads within one hour.On comparative analysis it was observed that immobilized cells could synthesize alpha amylase at similar levels with free cells of B.polymyxa.On Co-immobilization of B.Polymyxa with S.cerevisiae,the co-immobilizate beads could effeciently convert starch directly to ethanol with a yield of 14.8% at 1 : 2 ratio.

The Major Digestive Enzymes in Etroplus suratensis and Oreochromis mossambicus: Distribution and Characteristics

The major digestive enzyme activities and digestive indices were compared between Etroplus suratensis and Oreochromis mossambicus. Pepsin - like acid proteases that acts on low pH has been identified all along the digestive tract of both the fishes. Comparatively low alpha amylase activity is shown by the E. suratensis and the enzyme is distributed almost equally throughout the intestinal segments in both the species. Very low alkaline protease activity is found in the stomach of both the fishes and in O. mossambicus, the enzyme activity diminishes extensively towards the posterior portion of the intestine whereas in E. suratensis the activity increases towards the posterior part. The present study showed that lipase is one of the prominent digestive enzymes in O. mossambicus with a remarkable specific activity throughout the digestive tract than that of E. suratensis .It has been noted that O. mossambicus has a higher values for digestive somatic index, hepato somatic index, intestinal coefficient and gut Vs standard length ratio than that of E. suratensis indicating its higher digestive and metabolic capabilities. The early maturity and fast growth of O. mossambicus can be explained by their enhanced digestive indices. The compa ratively low activities of acid protease, amylase, lipase and total alkaline protease of E. suratensis revealed poor digestive capacity than that of O. mossambicus

Die Natur als Erholungs(t)raum

Zur Erholung in die Natur gehen oder doch lieber zur Natursimulation greifen? Intuitiv würden die meisten Menschen der Natur einen größeren Erholungswert zusprechen als einer Natursimulation. Aber ist die Natur tatsächlich erholsamer? In der Naturerholungsforschung (Restorative Environment Research) kommen häufig Natursimulationen zum Einsatz, um die erholsame Wirkung von Natur zu ermitteln. Problematisch ist dabei, dass deren ökologische Validität und Vergleichbarkeit noch nicht empirisch abgesichert ist. Vorliegende Arbeit setzt an dieser methodischen und empirischen Lücke an. Sie überprüft sowohl die ökologische Validität als auch die Vergleichbarkeit von Natursimulationen. Dazu wird die erholsame Wirkung von zwei Natursimulationen im Vergleich zu der physisch-materiellen Natur empirisch untersucht und verglichen. Darüber hinaus werden Aspekte des subjektiven Erlebens und der Bewertung im Naturerholungskontext exploriert. Als bedeutsamer Wirkmechanismus wird die erlebnisbezogene Künstlichkeit/Natürlichkeit angesehen, die sich auf die Erlebnisqualität von Natursimulationen und der physisch-materiellen Natur bezieht: Natursimulationen weisen im Vergleich zur physisch-materiellen Natur eine reduzierte Erlebnisqualität auf (erlebnisbezogene Künstlichkeit), z.B. eine reduzierte Qualität und Quantität der Sinnesansprache. Stellt man einen derartigen Vergleich nicht nur mit der physisch-materiellen Natur, sondern mit unterschiedlichen Natursimulationstypen an, dann zeigen sich auch hier Unterschiede in der erlebnisbezogenen Künstlichkeit. Beispielsweise unterscheidet sich ein Naturfoto von einem Naturfilm durch das Fehlen von auditiven und bewegten Stimuli. Diese erlebnisbezogene Künstlichkeit kann die erholsame Wirkung von Natur - direkt oder indirekt über Bewertungen - hemmen. Als Haupthypothese wird angenommen, dass mit zunehmendem Ausmaß an erlebnisbezogener Künstlichkeit die erholsame Wirkung der Natur abnimmt. Dem kombinierten Feld- und Laborexperiment liegt ein einfaktorielles Vorher-Nachher-Design zugrunde. Den 117 Probanden wurde zunächst eine kognitiv und affektiv belastende Aufgabe vorgelegt, danach folgte die Erholungsphase. Diese bestand aus einem Spaziergang, der entweder in der physisch-materiellen Natur (urbaner Park) oder in einer der beiden audio-visuellen Natursimulationen (videogefilmter vs. computergenerierter Spaziergang durch selbigen urbanen Park) oder auf dem Laufband ohne audio-visuelle Darbietung stattfand. Die erlebnisbezogene Künstlichkeit/Natürlichkeit wurde also wie folgt operationlisiert: die physische Natur steht für die erlebnisbezogene Natürlichkeit. Die beiden Natursimulationen stehen für die erlebnisbezogene Künstlichkeit. Die computergenerierte Version ist im Vergleich zur Videoversion erlebnisbezogen künstlicher, da sie weniger fotorealistisch ist. Die Zuordnung zu einer der vier experimentellen Erholungssettings erfolgte nach dem Zufallsprinzip. Die Effekte von moderater Bewegung wurden in den Natursimulationen durch das Laufen auf dem Laufband kontrolliert. Die Beanspruchungs- bzw. Erholungsreaktionen wurden auf kognitiver (Konzentriertheit, Aufmerksamkeitsleistung) affektiver (3 Befindlichkeitsskalen: Wachheit, Ruhe, gute Stimmung) und physiologischer (Alpha-Amylase) Ebene gemessen, um ein umfassendes Bild der Reaktionen zu erhalten. Insgesamt zeigen die Ergebnisse, dass die beiden Natursimulationen trotz Unterschiede in der erlebnisbezogenen Künstlichkeit/Natürlichkeit zu relativ ähnlichen Erholungsreaktionen führen, wie die physisch-materielle Natur. Eine Ausnahme stellen eine der drei affektiven (Wachheit) und die physiologische Reaktion dar: Probanden der physisch-materiellen Naturbedingung geben an wacher zu sein und weisen - wider erwarten - eine höhere physiologische Erregung auf. Demnach ist die physisch-materielle Natur nicht grundsätzlich erholsamer als die Natursimulationen. Die Hypothese ließ sich somit nicht bestätigen. Vielmehr deuten sich komplexe Erholungsmuster und damit auch unterschiedliche Erholungsqualitäten der Settings an, die einer differenzierten Betrachtung bedürfen. Für die ökologische Validität von Natursimulationen gilt, dass diese nur mit Einschränkung als ökologisch valide bezeichnet werden können, d.h. nur für bestimmte, aber nicht für alle Erholungsreaktionen. Die beiden Natursimulationen führen ebenfalls trotz Unterschiede in der erlebnisbezogenen Künstlichkeit zu ähnlichen Erholungsreaktionen und können somit als gleichwertig behandelt werden. Erstaunlicherweise kommt es hier zu ähnlichen Erholungsreaktionen, obwohl die bestehenden Unterschiede von den Probanden wahrgenommen und die erlebnisbezogen künstlichere computergenerierte Version negativer bewertet wird. Aufgrund der nicht erwartungskonformen Ergebnisse muss das Erklärungskonzept der erlebnisbezogenen Künstlichkeit/Natürlichkeit infrage gestellt werden. Alternative Erklärungskonzepte für die Ergebnisse („Ungewissheit“, mentale räumliche Modelle), die sich andeutenden unterschiedlichen Erholungsqualitäten der Settings, methodische Einschränkungen sowie die praktische Bedeutung der Ergebnisse werden kritisch diskutiert.

Use of fibrolytic enzymes to improve the nutritive value of ruminant diets - A biochemical and in vitro rumen degradation assessment

Two commercial enzyme products, Depol 40 (D) and Liquicell 2500 (L), were characterised from a biochemical standpoint and their potential to improve rumen degradation of forages was evaluated in vitro. Enzyme activities were determined at pH 5.5 and 39 degreesC. Analysis of the enzyme activities indicated that L contained higher xylanase and endoglucanase, but lower exoglucanase, pectinase and alpha-amylase activities than D. The Reading Pressure Technique (RPT) was used to investigate the effect of enzyme addition on the in vitro gas production (GP) and organic matter degradation (OMD) of alfalfa (Medicago sativa L.) stems and leaves. A completely randomised design with factorial arrangement of treatments was used. Both alfalfa fractions were untreated or treated with each enzyme at four levels, 20 h before incubation with rumen fluid. Each level of enzyme provided similar amounts of filter paper (D1, L1), endoglucanase (D2, L2), alpha-L-arabinofuranosidase (D3, L3) and xylanase units (D4, L4) per gram forage DM. Enzymes increased the initial OMD in both fractions, with improvements of up to 15% in leaves (D4) and 8% in stems (L2) after 12 h incubation. All enzyme treatments increased the extent of degradation (96 h incubation) in the leaf fractions, but only L2 increased final OMD in the stems. Direct hydrolysis of forage fractions during the pre-treatment period did not fully account for the magnitude of the increases in OMD, suggesting that the increase in rate of degradation was achieved through a combined effect of direct enzyme hydrolysis and synergistic action between the exogenous (applied) and endogenous (rumen) enzymes. (C) 2003 Elsevier Science B.V. All rights reserved.

In vitro evaluation of fibrolytic enzymes as additives for maize (Zea mays L.) silage - I. Effects of ensiling temperature, enzyme source and addition level

A series of experiments was completed to investigate the impact of addition of enzymes at ensiling on in vitro rumen degradation of maize silage. Two commercial products, Depot 40 (D, Biocatalysts Ltd., Pontypridd, UK) and Liquicell 2500 (L, Specialty Enzymes and Biochemicals, Fresno, CA, USA), were used. In experiment 1, the pH optima over a pH range 4.0-6.8 and the stability of D and L under changing pH (4.0, 5.6, 6.8) and temperature (15 and 39 degreesC) conditions were determined. In experiment 2, D and L were applied at three levels to whole crop maize at ensiling, using triplicate 0.5 kg capacity laboratory minisilos. A completely randomized design with a factorial arrangement of treatments was used. One set of treatments was stored at room temperature, whereas another set was stored at 40 degreesC during the first 3 weeks of fermentation, and then stored at room temperature. Silages were opened after 120 days. Results from experiment I indicated that the xylanase activity of both products showed an optimal pH of about 5.6, but the response differed according to the enzyme, whereas the endoglucanase activity was inversely related to pH. Both products retained at least 70% of their xylanase activity after 48 h incubation at 15 or 39 degreesC. In experiment 2, enzymes reduced (P < 0.05) silage pH, regardless of storage temperature and enzyme level. Depol 40 reduced (P < 0.05) the starch contents of the silages, due to its high alpha-amylase activity. This effect was more noticeable in the silages stored at room temperature. Addition of L reduced (P < 0.05) neutral detergent fiber (NDF) and acid detergent fiber (ADF) contents. In vitro rumen degradation, assessed using the Reading Pressure Technique (RPT), showed that L increased (P < 0.05) the initial 6 h gas production (GP) and organic matter degradability (OMD), but did not affect (P > 0.05) the final extent of OMD, indicating that this preparation acted on the rumen degradable material. In contrast, silages treated with D had reduced (P < 0.05) rates of gas production and OMD. These enzymes, regardless of ensiling temperature, can be effective in improving the nutritive quality of maize silage when applied at ensiling. However, the biochemical properties of enzymes (i.e., enzymic activities, optimum pH) may have a crucial role in dictating the nature of the responses. (C) 2003 Elsevier B.V. All rights reserved.

Influence of foliar diseases and their control by fungicides on grain yield and quality in wheat

Twenty-eight field experiments on sandy-loam soils in the UK (1982-2003) are reviewed by relating the extension of the green area duration of the flag leaf (GLADF) by fungicides to effects on yield and quality of winter wheat. Over all experiments mean grain yield = 8.85t ha(-1) at 85% DM. With regards quality, mean values were: thousand grain weight (TGW) = 44.5 g; specific weight (SWT) = 76.9 kg hl(-1); crude protein concentration (CP (N x 5.7)) = 12.5 % DM; Hagberg falling number (HFN) = 285 s; and sodium dodecyl sulphate (SDS)-sedimentation volume = 69ml. For each day (d) that fungicides increased GLADF there were associated average increases in yield (0.144 1 ha(-1) d(-1), se 0.0049, df = 333), TGW (0.56 gd(-1), se = 0.017) and SWT (0.22 kg hl(-1) d(-1), se 0.011). Some curvature was evident in all these relationships. When GLADF was delayed beyond 700 degrees Cd after anthesis, as was possible in cool wet seasons, responses were curtailed, or less reliable. Despite this apparent terminal sink limitation, fungicide effects on sink size, eg endosperm cell numbers or maximum water mass per grain, were not prerequisites for large effects on grain yield, TGW or SWT. Fungicide effects on CP were variable. Although the average response of CP was negative (-0.029%DM/d; se = 0.00338), this depended on cultivar and disease controlled. Controlling biotrophs such as rusts, (Puccinia spp.) tended to increase CP, whereas controlling a more necrotrophic pathogen (Septoria tritici) usually reducedCP. Irrespective of pathogen controlled, delaying senescence of the flag leaf was associated with increased nitrogen yields in the grain (averaging 2.24 kg N ha-1 d(-1), se = 0.0848) due to both increased N uptake into the above ground crop, and also more efficient remobilisation of N from leaf laminas. When sulphur availability appeared to be adequate, fungicide x cultivar interactions were similar on S as for CP, although N:S ratios tended to decline (i.e. improve for bread making) when S. tritici was controlled. On average, SDS-sedimentation volume declined (-0. 18 ml/d, se = 0.027) with increased GLADF, broadly commensurate with the average effect on CP. Hagberg falling number decreased as fungicide increased GLADF (-2.73 s/d, se = 0.178), indicating an increase in alpha-amylase activity.

Milling performance of north European hull-less barleys and characterization of resultant millstreams

Four hull-less barley samples were milled on a Buhler MLU 202 laboratory mill and individual and combined milling fractions were characterized. The best milling performance was obtained when the samples were conditioned to 14.3% moisture. Yields were 37-48% for straight-run flour, 47-56% for shorts, and 5-8% for bran. The beta-glucan contents of the straight-run white flours were 1.6-2.1%, of which approximate to49% was water-extractable. The arabinoxylan contents were 1.2-1.5%, of which approximate to17% was water-extractable. Shorts and bran fractions contained more beta-glucan (4.2-5.8% and 3.0-4.7%, respectively) and arabinoxylan (6.1-7.7% and 8.1-11.8%, respectively) than the white flours. For those fractions, beta-glucan extractability was high (58.5 and 52.3%, respectively), whereas arabinoxylan extractability was very low (approximate to6.5 and 2.0%, respectively). The straight-run white flours had low alpha-amylase, beta-glucanase, and endoxylanase activities. The highest alpha-amylase activity was found in the shorts fractions and the highest beta-glucanase and endoxylanase activities were generally found in the bran fractions. Endoxylanase inhibitor activities were low in the white flours and highest in the shorts fractions. High flavanoid, tocopherol, and tocotrienol contents were found in bran and shorts fractions.

The role played by the interaction between genetic factors and attachment in the stress response in infancy

Background: The importance of understanding which environmental and biological factors are involved in determining individual differences in physiological response to stress is widely recognized, given the impact that stress has on physical and mental health. Methods: The child-mother attachment relationship and some genetic polymorphisms (5-HTTLPR, COMT and GABRA6) were tested as predictors of salivary cortisol and alpha amylase concentrations, two biomarkers of hypothalamic-pituitary-adrenocortical (HPA) axis and sympathetic adrenomedullary (SAM) system activity, during the Strange Situation (SS) procedure in a sample of more than 100 healthy infants, aged 12 to 18 months. Results: Individual differences in alpha amylase response to separation were predicted by security of attachment in interaction with 5-HTTLPR and GABRA6 genetic polymorphisms, whereas alpha amylase basal levels were predicted by COMT x attachment interaction. No significant effect of attachment, genetics and their interaction on cortisol activity emerged. Conclusions: These results help to disentangle the role played by both genetic and environmental factors in determining individual differences in stress response in infancy. The results also shed light on the suggestion that HPA and SAM systems are likely to have different characteristic responses to stress.

Physiological responses to psychological stress: importance of adiposity in men aged 50-70 years

We tested the hypothesis that overweight/obese men aged 50–70 years will have a greater salivary cortisol, salivary alpha amylase and heart rate (HR) responses to psychological stress compared with age matched lean men. Lean (BMIZ20–25 kg/m2; nZ19) and overweight/obese (BMIZ27–35 kg/m2; nZ17) men (50–70 years) were subjected to a well-characterised psychological stress (Trier Social Stress Test, TSST) at 1500 h. Concentrations of cortisol and alpha amylase were measured in saliva samples collected every 7–15 min from 1400 to 1700 h. HR was recorded using electrocardiogram. Body weight, BMI, percentage body fat, resting systolic and diastolic blood pressure and mean arterial pressure were significantly higher (P!0.05) in overweight/obese men compared with lean men. Both groups responded to the TSST with a substantial elevation in salivary cortisol (372%), salivary alpha amylase (123%) and HR (22%). These responses did not differ significantly between the groups (time!treatment interaction for salivary cortisol, salivary alpha amylase and HR; PZ0.187, PZ0.288, PZ0.550, respectively). There were no significant differences between the groups for pretreatment values, peak height, difference between pretreatment values and peak height (reactivity) or area under the curve for salivary cortisol, salivary alpha amylase or HR (PO0.05 for all). The results showed that, for men with a moderate level of overweight/obesity who were otherwise healthy, the response of salivary cortisol, salivary alpha amylase and HR to acute psychological stress was not impaired.

Starch metabolism in Leucoagaricus gongylophorus, the symbiotic fungus of leaf-cutting ants

Leucoagaricus gongylophorus, the symbiotic fungus of the leaf-cutting ants, degrades starch, this degradation being supposed to occur in the plant material which leafcutters forage to the nests, generating most of the glucose which the ants utilize for food. In the present investigation, we show that laboratory cultures of L. gongylophorus produce extracellular alpha-amylase and maltase which degrade starch to glucose, reinforcing that the ants can obtain glucose from starch through the symbiotic fungus. Glucose was found to repress a-amylase and, more severely, maltase activity, thus repressing starch degradation by L. gongylophorus, so that we hypothesize that: (1) glucose down-regulation of starch degradation also occurs in the Atta sexdens fungus garden; (2) glucose consumption from the fungus garden by A. sexdens stimutates degradation of starch from plant material by L. gongylophorus, which may represent a mechanism by which Leafcutters can control enzyme production by the symbiotic fungus. Since glucose is found in the fungus garden inside the nests, down-regulation of starch degradation by glucose is supposed to occur in the nest and play a part in the control of fungal enzyme production by leafcutters. (c) 2005 Elsevier GmbH. All rights reserved.

Resistance of stored bean varieties to Acanthoscelides obtectus (Coleoptera : Bruchidae)

During bean seed storage, yield can be lost due to infestations of Acanthoscelides obtectus Say, the bean weevil. The use of resistant varieties has shown promising results in fighting these insects, reducing infestation levels and eliminating chemical residues from the beans. The expression of resistance to A. obtectus in bean varieties is frequently attributed to the presence of phytohemagglutinins, protease inhibitors and alpha-amylase, and especially to variants of the protein arcelin, which reduce the larval viability of these insects. To evaluate the effect of bean seed storage time on the resistance expression of bean varieties to A. obtectus, tests with seeds of three ages (freshly-harvested, 4-month-old, and 8-month-old) were conducted in the laboratory, using four commercial varieties: Carioca Pitoco, Ipa 6, Porrillo 70, Onix; four improved varieties containing arcelin protein: Are. 1, Arc.2, Arc. 3, Arc.4; and three wild varieties also containing arcelin protein: Arc. IS, Arc.3S, and Arc. 5S. The Arc.5S, Arc. IS, and Arc.2 varieties expressed high antibiosis levels against the weevil; Arc. I and Arc3S expressed the same mechanism, but at lower levels. The occurrence of oviposition non-preference was also observed in Arc.5S and Arc. IS. The Arc.3 and Arc. 4 varieties expressed low feeding non-preference levels against A. obtectus. The expression of resistance in arcelin-bearing, wild or improved varieties was affected during the storage of seeds, and was high under some parameters but low in others. The results showed that addition of chemical resistance factors such as protein arcelin via genetic breeding may be beneficial in improving the performance of bean crops.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Atividade amilolítica e qualidade fisiológica de sementes armazenadas de milho super doce tratadas com ácido giberélico

O uso de reguladores de crescimento na fase de germinação melhora o desempenho das plântulas, acelerando a velocidade de emergência e realçando o potencial das sementes de várias espécies, mesmo sob condições adversas. Este trabalho teve como objetivo avaliar a influência do ácido giberélico na atividade amilolítica e no vigor de sementes armazenadas de milho super doce. O experimento foi conduzido nos Laboratórios de Análise de Sementes do Departamento de Produção Vegetal/FCA e no Laboratório de Bioquímica de Plantas do Departamento de Química e Bioquímica/IB da Universidade Estadual Paulista (UNESP/Botucatu), entre os meses de julho e setembro de 2001, onde foram feitas as avaliações da qualidade fisiológica, através dos testes de germinação, vigor e bioquímicos. Sementes de milho super doce da cultivar DO-04, foram acondicionadas em sacos de papel e armazenadas por oito meses em câmara seca (40% UR). Após este período, foram colocadas para germinar em rolos de papel toalha, embebidos com GA3 nas concentrações zero; 50; 100; 150 e 200mg.L-1. Foram avaliadas a germinação, vigor e atividade amilolítica das sementes. As sementes submetidas à pré-embebição em solução de 50mg.L-1 de ácido giberélico, apresentaram maior germinação e vigor, menor teor de proteínas totais e maior atividade amilolítica.

Estudo da funcionalidade de espécies comestíveis do semiárido nordestino e estratégias para sua utilização como ingredientes para fins alimentícios

The Brazilian caatinga is characterized by low annual rainfall and arid soils. Several cactaceae, either native or adapted species, grow in this semi-arid region, including the prickly pear (Opuntia fícus indica) and facheiro ((Philosocereus pachycladus Ritter) which produce underexploited edible fruits. In addition to these species, the algaroba is a leguminous with little studied technological applications and bioactive potential so far. Therefore, this research aims to investigate the physicochemical, bioactive and functional attributes of the prickly pear and facheiro fruit pulps and the algaroba flour. Specifically, this study approaches the physicochemical characterization, total phenolic compounds (TPC) and the betalain identification and quantification by HPLC-DAD-ESI-MS. It is also investigated the DPPH antioxidant capacity and the antienzymatic activities against alpha-amylase and alphaglucosidase of water and ethanolic extracts of these food material. In order to address their potential to be used as food ingredients, juice blends prepared with mixtures of cajá and prickly pear, biofilms with facheiro and cereal bars with algaroba flour were elaborated and analyzed. The prickly pear fruits presented low acidity and high sugar content when compared to facheiro. The Philosocereus pachycladus Ritter fruits had higher protein and ash content, but the algaroba flour was the species with higher protein and sugar content among all. The algaroba flour also presented outstanding food fiber content, which reveals its potentiality to be used as a natural intestinal regulator. The TPC of water and ethanol extracts ranged from 3.87 to 16.21 mg GAE/100g for algaroba flour, 79.24 to 110.20 GAE/ 100g for prickly pear and 412.23 to 539.14 mg GAE/100g for facheiro. The 70% (w/v) ethanol extract reached the highest DPPH antioxidant activity, which was linearly correlated to its high TPC content. In regard to the enzymatic inhibitory activities, the best performance was observed for the prickly pear extracts which presented a moderate inhibition for both investigated enzymes, but interestingly, no alpha-glucosidase inhibition was observed for facheiro extracts. This work shows, for the first time in the literature, the functional attributes of facheiro fruits, as well as the presence of betacianins and isobetanin in the pulp of this exotic fruit. When it comes to the food products developed here, the sensory attributes that better described the juice blend cajá-prickly pear were sweetness, acidity, color yellow-orange, body, turbidity and cajá flavor. The discriminative test applied for cereal bars produced with and without algaroba revealed that the texture was the only sensory attribute that differed (p<0.05) between these two samples. It was also observed that the addition of facheiro extracts did not influence the visual characteristics of the biofilms. Overall, this work unveils the physicochemical and bioactive attributes of these commercial and technologically underexploited species widely found in the Brazilian caatinga and presents alternatives for their rational use

Effects and toxicity of Eugenia punicifolia extracts in streptozotocin-diabetic rats

Extracts and decoctions of Eugenia jambolana Lam., Eugenia uniflora L., and Eugenia punicifolia (Humb., Bonpl. & Kunt) DC. are used in traditional medicine to treat diabetes mellitus. Although there have been reports that Eugenia jambolana and Eugenia uniflora have antidiabetic effects, no study has yet been made on Eugenia punicifolia . We investigated the effects of aqueous, butanol, and methanol extracts of Eugenia punicifolia leaves administered by gavage to streptozotocin-diabetic rats for 26 to 29 days. Body weight, food and fluid intake, urine volume, and urinary glucose and urea were evaluated every 7 days. At the end of the experiment, we measured serum cholesterol, high-density lipoprotein (HDL)-cholesterol, triglycerides and bilirubin, hepatic glycogen and serum marker-enzymes (alanine and aspartate aminotransferases, alkaline phosphatase, gamma-glutamyltransferase, L-lactate dehydrogenase, creatine kinase, alpha-amylase, and angiotensin I converting enzyme). We found that in rats treated with the aqueous extracts, food and liquid intake, urinary volume, and body weight were all reduced, while for rats treated with the methanol extract, not only were liquid intake, urinary volume and body weight reduced, but urinary glucose and urea also decreased. Rats treated with the butanol extract showed no significant alterations in any of the parameters measured. Chronic treatment with extracts had no effect on the marker enzymes nor on serum bilirubin levels. The results indicate that aqueous extracts of Eugenia punicifolia leaves produced an anorexic effect and that methanol extracts had a beneficial effect on the diabetic state by improving carbohydrate and protein metabolism without provoking hepatobiliary, microvascular, muscular, or pancreatic toxic effects.