973 resultados para Regulatory Elements, Transcriptional
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Background: Regulation of gene expression in Plasmodium falciparum (Pf) remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results: The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS); this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion: The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.
Resumo:
A great deal of experimental studies have shown that many introns of eukaryotic genes function as regulators of transcription. However, comprehensive studies of this problem have not yet been conducted. After checking the transcription frequencies of some Saccharomyces cerevisiae (yeast), genes and their introns, a remarkable phenomenon was discovered that generally the introns of the genes with higher transcription frequencies are longer, and the introns of the genes with lower transcription frequencies are shorter. This suggests that the longer introns of genes with higher transcription frequencies may contain some characteristic sequence structures, which could enhance the transcription of genes. Therefore, two sets of introns of yeast genes were chosen for further study. The transcription frequencies of the first set of genes are higher (>30), and those of the second set of genes are lower (less than or equal to10). Some oligonucleotides are detected by statistically comparative analyses of the occurrence frequencies of oligonucleotides (mainly tetranucleotides and pentanucleotides), whose occurrence frequencies in the first set of introns; are significantly higher than those in the second set of introns, and are also significantly higher than those in the exons flanking the introns of the first set. Some of these extracted oligonucleotides are the same as the regulatory elements of transcription revealed by experimental analyses. Besides, the distributions of these extracted oligonucleotides in the two sets of introns and the exons show that the sequence structures of the first set of introns are favorable for transcription of genes.
Resumo:
We conducted a comparative statistical analysis of tetra- through hexanucleotide frequencies in two sets of introns of yeast genes. The first set consisted of introns of genes that have transcription rates higher than 30 mRNAs/h while the second set contained introns of genes whose transcription rates were lower than or equal to 10 mRNAs/h. Some oligonucleotides whose occurrence frequencies in the first set of introns are significantly higher than those in the second set of introns were detected. The frequencies of occurrence of most of these detected oligonucleotides are also significantly higher than those in the exons flanking the introns of the first set. Interestingly some of these detected oligonucleotides are the same as well known "signature" sequences of transcriptional regulatory elements. This could imply the existence of potential positive regulatory motifs of transcription in yeast introns. (C) 2003 Elsevier Ltd. All rights reserved.
Resumo:
HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-gamma and NF-kappa B, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3' untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3' UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region.
Resumo:
Cytochrome P450 1A1 (CYP1A1) monooxygenase plays an important role in the metabolism of environmental pollutants such as polycyclic aromatic hydrocarbons (PAHs) and halogenated polycyclic aromatic hydrocarbons (HAHs). Oxidation of these compounds converts them to the metabolites that subsequently can be conjugated to hydrophilic endogenous entities e.g. glutathione. Derivates generated in this way are water soluble and can be excreted in bile or urine, which is a defense mechanism. Besides detoxification, metabolism by CYP1A1 may lead to deleterious effects since the highly reactive intermediate metabolites are able to react with DNA and thus cause mutagenic effects, as it is in the case of benzo(a) pyrene (B[a]P). CYP1A1 is normally not expressed or expressed at a very low level in the cells but it is inducible by many PAHs and HAHs e.g. by B[a]P or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Transcriptional activation of the CYP1A1 gene is mediated by aryl hydrocarbon receptor (AHR), a basic-helix-loop-helix (bHLH) transcription factor. In the absence of a ligand AHR stays predominantly in the cytoplasm. Ligand binding causes translocation of AHR to the nuclear compartment, its heterodimerization with another bHLH protein, the aryl hydrocarbon nuclear translocator (ARNT) and binding of the AHR/ARNT heterodimer to a DNA motif designated dioxin responsive element (DRE). This process leads to the transcriptional activation of the responsive genes containing DREs in their regulatory regions, e.g. that coding for CYP1A1. TCDD is the most potent known agonist of AHR. Since it is not metabolized by the activated enzymes, exposure to this compound leads to a persisting activation of AHR resulting in diverse toxic effects in the organism. To enlighten the molecular mechanisms that mediate the toxicity of xenobiotics like TCDD and related compounds, the AHR-dependent regulation of the CYP1A1 gene was investigated in two cell lines: human cervix carcinoma (HeLa) and mouse hepatoma (Hepa). Study of AHR activation and its consequence concerning expression of the CYP1A1 enzyme confirmed the TCDD-dependent formation of the AHR/ARNT complex on DRE leading to an increase of the CYP1A1 transcription in Hepa cells. In contrast, in HeLa cells formation of the AHR/ARNT heterodimer and binding of a protein complex containing AHR and ARNT to DRE occurred naturally in the absence of TCDD. Moreover, treatment with TCDD did not affect the AHR/ARNT dimer formation and binding of these proteins to DRE in these cells. Even though the constitutive complex on DRE exists in HeLa, transcription of the CYP1A1 gene was not increased. Furthermore, the CYP1A1 level in HeLa cells remained unchanged in the presence of TCDD suggesting repressional mechanism of the AHR complex function which may hinder the TCDD-dependent mechanisms in these cells. Similar to the native, the mouse CYP1A1-driven reporter constructs containing different regulatory elements were not inducible by TCDD in HeLa cells, which supported a presence of cell type specific trans-acting factor in HeLa cells able to repress both the native CYP1A1 and CYP1A1-driven reporter genes rather than species specific differences between CYP1A1 genes of human and rodent origin. The different regulation of the AHR-mediated transcription of CYP1A1 gene in Hepa and HeLa cells was further explored in order to elucidate two aspects of the AHR function: (I) mechanism involved in the activation of AHR in the absence of exogenous ligand and (II) factor that repress function of the exogenous ligand-independent AHR/ARNT complex. Since preliminary studies revealed that the activation of PKA causes an activation of AHR in Hepa cells in the absence of TCDD, the PKA-dependent signalling pathway was the proposed endogenous mechanism leading to the TCDD-independent activation of AHR in HeLa cells. Activation of PKA by forskolin or db-cAMP as well as inhibition of the kinase by H89 in both HeLa and Hepa cells did not lead to alterations in the AHR interaction with ARNT in the absence of TCDD and had no effect on binding of these proteins to DRE. Moreover, the modulators of PKA did not influence the CYP1A1 activity in these cells in the presence and in the absence of TCDD. Thus, an involvement of PKA in the regulation of the CYP1A1 Gen in HeLa cells was not evaluated in the course of this study. Repression of genes by transcription factors bound to their responsive elements in the absence of ligands has been described for nuclear receptors. These receptors interact with protein complex containing histone deacetylase (HDAC), enzyme responsible for the repressional effect. Thus, a participation of histone deacetylase in the transcriptional modulation of CYP1A1 gene by the constitutively DNA-bound AHR/ARNT complex was supposed. Inhibition of the HDAC activity by trichostatin A (TSA) or sodium butyrate (NaBu) led to an increase of the CYP1A1 transcription in the presence but not in the absence of TCDD in Hepa and HeLa cells. Since amount of the AHR and ARNT proteins remained unchanged upon treatment of the cells with TSA or NaBu, the transcriptional upregulation of CYP1A1 gene was not due to an increased expression of the regulatory proteins. These findings strongly suggest an involvement of HDAC in the repression of the CYP1A1 gene. Similar to the native human CYP1A1 also the mouse CYP1A1-driven reporter gene transfected into HeLa cells was repressed by histone deacetylase since the presence of TSA or NaBu led to an increase in the reporter activity. Induction of reporter gene did not require a presence of the promoter or negative regulatory regions of the CYP1A1 gene. A promoter-distal fragment containing three DREs together with surrounding sequences was sufficient to mediate the effects of the HDAC inhibitors suggesting that the AHR/ARNT binding to its specific DNA recognition site may be important for the CYP1A1 repression. Histone deacetylase is recruited to the specific genes by corepressors, proteins that bind to the transcription factors and interact with other members of the HDAC complex. Western blot analyses revealed a presence of HDAC1 and the corepressors mSin3A (mammalian homolog of yeast Sin3) and SMRT (silencing mediator for retinoid and thyroid hormone receptor) in both cell types, while the corepressor NCoR (nuclear receptor corepressor) was expressed exclusively in HeLa cells. Thus the high inducibility of CYP1A1 in Hepa cells may be due to the absence of NCoR in these cells in contrast to the non-responsive HeLa cells, where the presence of NCoR would support repression of the gene by histone deacetylase. This hypothesis was verified in reporter gene experiments where expression constructs coding for the particular members of the HDAC complex were cotransfected in Hepa cells together with the TCDD-inducible reporter constructs containing the CYP1A1 regulatory sequences. An overexpression of NCoR however did not decrease but instead led to a slight increase of the reporter gene activity in the cells. The expected inhibition was observed solely in the case of SMRT that slightly reduced constitutive and TCDD-induced reporter gene activity. A simultaneous expression of NCoR and SMRT shown no further effects and coexpression of HDAC1 with the two corepressors did not alter this situation. Thus, additional factors that are likely involved in the repression of CYP1A1 gene by HDAC complex remained to be identified. Taking together, characterisation of an exogenous ligand independent AHR/ARNT complex on DRE in HeLa cells that repress transcription of the CYP1A1 gene creates a model system enabling investigation of endogenous processes involved in the regulation of AHR function. This study implicates HDAC-mediated repression of CYP1A1 gene that contributes to the xenobiotic-induced expression in a tissue specific manner. Elucidation of these processes gains an insight into mechanisms leading to deleterious effects of TCDD and related compounds.
Resumo:
Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.
Resumo:
The expression of the chicken fast skeletal myosin alkali light chain (MLC) 3f is subject to complex patterns of control by developmental and physiologic signals. Regulation over MLC3f gene expression is thought to be exerted primarily at the transcriptional level. The purpose of this dissertation was to identify cis-acting elements on the 5$\sp\prime$ flanking region of chicken MLC3f gene that are important for transcriptional regulation. The results show that the 5$\sp\prime$ flanking region of MLC3f gene contains multiple cis-acting elements. The nucleotide sequence of these elements demonstrates a high degree of conservation between different species and are also found in the 5$\sp\prime$ flanking regions of many muscle protein genes. The first regulatory region is located between $-$185 and $-$150 bp from the transcription start site and contains an AT-rich element. Linker scanner analyses have revealed that this element has a positive effect on transcription of the MLC3f promoter. Furthermore, when linked to a heterologous viral promoter, it can enhance reporter gene expression in a muscle-specific manner, independent of distance or orientation.^ The second regulatory region is located between $-$96 and $-$64 from the transcription start site. Sequences downstream of $-$96 have the capacity to drive muscle-specific reporter gene expression, although the region between $-$96 and $-$64 has no intrinsic enhancer-like activity. Linker scanner analyses have identified a GC-rich motif that required efficient transcription of the MLC3f promoter. Mutations to this region of DNA results in diminished capacity to drive reporter gene expression and is correlated with disruption of the ability to bind sequence-specific transcription factors. These sequence-specific DNA-binding proteins were detected in both muscle and non-muscle extracts. The results suggest that the mere presence or absence of transcription factors cannot be solely responsible for regulation of MLC3f expression and that tissue-specific expression may arise from complex interactions with muscle-specific, as well as more ubiquitous transcription factors with multiple regulatory elements on the gene. ^
Resumo:
The Wilms' tumor 1 gene (WT1) encodes a zinc-finger transcription factor and is expressed in urogenital, hematopoietic and other tissues. It is expressed in a temporal and spatial manner in both embryonic and adult stages. To obtain a better understanding of the biological function of WT1, we studied two aspects of WT1 regulation: one is the identification of tissue-specific cis-regulatory elements that regulate its expression, the other is the downstream genes which are modulated by WT1.^ My studies indicate that in addition to the promoter, other regulatory elements are required for the tissue specific expression of this gene. A 259-bp hematopoietic specific enhancer in intron 3 of the WT1 gene increased the transcriptional activity of the WT1 promoter by 8- to 10-fold in K562 and HL60 cells. Sequence analysis revealed both GATA and c-Myb motifs in the enhancer fragment. Mutation of the GATA motif decreased the enhancer activity by 60% in K562 cells. Electrophoretic mobility shift assays showed that both GATA-1 and GATA-2 proteins in K562 nuclear extracts bind to this motif. Cotransfection of the enhancer containing reporter construct with a GATA-1 or GATA-2 expression vector showed that both GATA-1 and GATA-2 transactivated this enhancer, increasing the CAT reporter activity 10-15 fold and 5-fold respectively. Similar analysis of the c-Myb motif by cotransfection with the enhancer CAT reporter construct and a c-Myb expression vector showed that c-Myb transactivated the enhancer by 5-fold. A DNase I-hypersensitive site has been identified in the 258 bp enhancer region. These data suggest that GATA-1 and c-Myb are responsible for the activity of this enhancer in hematopoietic cells and may bind to the enhancer in vivo. In the process of searching for cis-regulatory elements in transgenic mice, we have identified a 1.0 kb fragment that is 50 kb downstream from the promoter and is required for the central nervous system expression of WT1.^ In the search for downstream target genes of WT1, we noted that the proto-oncogene N-myc is coexpressed with the tumor suppressor gene WT1 in the developing kidney and is overexpressed in many Wilms' tumors. Sequence analysis revealed eleven consensus WT1 binding sites located in the 1 kb mouse N-myc promoter. We further showed that the N-myc promoter was down-regulated by WT1 in transient transfection assays. Electrophoretic mobility shift assays showed that oligonucleotides containing the WT1 motifs could bind WT1 protein. Furthermore, a Denys-Drash syndrome mutant of WT1, R394W, that has a mutation in the DNA binding domain, failed to repress the N-myc promoter. This suggests that the repression of the N-myc promoter is mediated by DNA binding of WT1. This finding helps to elucidate the relationship of WT1 and N-myc in tumorigenesis and renal development. ^
Resumo:
PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Caveolae form the terminus for a major pathway of intracellular free cholesterol (FC) transport. Caveolin mRNA levels in confluent human skin fibroblasts were up-regulated following increased uptake of low density lipoprotein (LDL) FC. The increase induced by FC was not associated with detectable change in mRNA stability, indicating that caveolin mRNA levels were mediated at the level of gene transcription. A total of 924 bp of 5′ flanking region of the caveolin gene were cloned and sequenced. The promoter sequence included three G+C-rich potential sterol regulatory elements (SREs), a CAAT sequence and a Sp1 consensus sequence. Deletional mutagenesis of individual SRE-like sequences indicated that of these two (at −646 and −395 bp) were essential for the increased transcription rates mediated by LDL-FC, whereas the third was inconsequential. Gel shift analysis of protein binding from nuclear extracts to these caveolin promoter DNA sequences, together with DNase I footprinting, confirmed nucleoprotein binding to the SRE-like elements as part of the transcriptional response to LDL-FC. A supershift obtained with antibody to SRE-binding protein 1 (SPEBP-1) indicated that this protein binds at −395 bp. There was no reaction at −395 bp with anti-Sp1 antibody nor with either antibody at −646 bp. The cysteine protease inhibitor N-acetyl-leu-leu-norleucinal (ALLN), which inhibits SREBP catabolism, superinhibited caveolin mRNA levels regardless of LDL-FC. This finding suggests that SREBP inhibits caveolin gene transcription in contrast to its stimulating effect on other promoters. The findings of this study are consistent with the postulated role for caveolin as a regulator of cellular FC homeostasis in quiescent peripheral cells, and the coordinate regulation by SREBP of FC influx and efflux.
RegulonDB (version 3.2): transcriptional regulation and operon organization in Escherichia coli K-12
Resumo:
RegulonDB is a database on mechanisms of transcription regulation and operon organization in Escherichia coli K-12. The current version has considerably increased numbers of regulatory elements such as promoters, binding sites and terminators. The complete repertoire of known and predicted DNA-binding transcriptional regulators can be considered to be included in this version. The database now distinguishes different allosteric conformations of regulatory proteins indicating the one active in binding and regulating the different promoters. A new set of operon predictions has been incorporated. The relational design has been modified accordingly. Furthermore, a major improvement is a graphic display enabling browsing of the database with a Java-based graphic user interface with three zoom-levels connected to properties of each chromosomal element. The purpose of these modifications is to make RegulonDB a useful tool and control set for transcriptome experiments. RegulonDB can be accessed on the web at the URL: http://www.cifn.unam.mx/Computational_Biology/regulondb/
Resumo:
Cellular exposure to hypoxia results in altered gene expression in a range of physiologic and pathophysiologic states. Discrete cohorts of genes can be either up- or down-regulated in response to hypoxia. While the Hypoxia-Inducible Factor (HIF) is the primary driver of hypoxia-induced adaptive gene expression, less is known about the signalling mechanisms regulating hypoxia-dependent gene repression. Using RNA-seq, we demonstrate that equivalent numbers of genes are induced and repressed in human embryonic kidney (HEK293) cells. We demonstrate that nuclear localization of the Repressor Element 1-Silencing Transcription factor (REST) is induced in hypoxia and that REST is responsible for regulating approximately 20% of the hypoxia-repressed genes. Using chromatin immunoprecipitation assays we demonstrate that REST-dependent gene repression is at least in part mediated by direct binding to the promoters of target genes. Based on these data, we propose that REST is a key mediator of gene repression in hypoxia.
Resumo:
Vertebrate genomes are organised into a variety of nuclear environments and chromatin states that have profound effects on the regulation of gene transcription. This variation presents a major challenge to the expression of transgenes for experimental research, genetic therapies and the production of biopharmaceuticals. The majority of transgenes succumb to transcriptional silencing by their chromosomal environment when they are randomly integrated into the genome, a phenomenon known as chromosomal position effect (CPE). It is not always feasible to target transgene integration to transcriptionally permissive “safe harbour” loci that favour transgene expression, so there remains an unmet need to identify gene regulatory elements that can be added to transgenes which protect them against CPE. Dominant regulatory elements (DREs) with chromatin barrier (or boundary) activity have been shown to protect transgenes from CPE. The HS4 element from the chicken beta-globin locus and the A2UCOE element from a human housekeeping gene locus have been shown to function as DRE barriers in a wide variety of cell types and species. Despite rapid advances in the profiling of transcription factor binding, chromatin states and chromosomal looping interactions, progress towards functionally validating the many candidate barrier elements in vertebrates has been very slow. This is largely due to the lack of a tractable and efficient assay for chromatin barrier activity. In this study, I have developed the RGBarrier assay system to test the chromatin barrier activity of candidate DREs at pre-defined isogenic loci in human cells. The RGBarrier assay consists in a Flp-based RMCE reaction for the integration of an expression construct, carrying candidate DREs, in a pre-characterised chromosomal location. The RGBarrier system involves the tracking of red, green and blue fluorescent proteins by flow cytometry to monitor on-target versus off-target integration and transgene expression. The analysis of the reporter (GFP) expression for several weeks gives a measure of the protective ability of each candidate elements from chromosomal silencing. This assay can be scaled up to test tens of new putative barrier elements in the same chromosomal context in parallel. The defined chromosomal contexts of the RGBarrier assays will allow for detailed mechanistic studies of chromosomal silencing and DRE barrier element action. Understanding these mechanisms will be of paramount importance for the design of specific solutions for overcoming chromosomal silencing in specific transgenic applications.